A solution of DNA is heated slowly until the tm is reached. What is the likely structure of the DNA molecules at this temperature?
We need at least 10 more requests to produce the answer.
0 / 10 have requested this problem solution
The more requests, the faster the answer.
A solution of DNA is heated slowly until the tm is reached. What is the likely...
a 20.94-g sample of an unknown metal is heated to 99.4 degrees Celsius in a hot water bath until thermal equilibrium is reached. The metal is quickly transferred to 100 mL of water at 22.0 degrees Celsius contained in a styrofoam cup. The thermal equilibrium temperature of the metal plus water mixture is 24.6 degrees Celsius. What is the Specific heat capacity of the metal?
What is the value of Tm (melting temperature) dependent on? Include a typical graph for DNA thermal denaturation and explain it qualitatively. Propose a method using UV spectroscopy to experimentally determine the melting temperature for DNA chains.
Solid silver acetate is slowly added to 125 mL of a potassium phosphate solution until the concentration of silver ion is 0.0287 M. The maximum amount of phosphate remaining in solution is ___ Solid sodium hydroxide is slowly added to 150 mL of a chromium(III) nitrate solution until the concentration of hydroxide ion is 0.0629 M. The maximum amount of chromium(III) ion remaining in solution is _____ Solid ammonium fluoride is slowly added to 150 mL of a 0.366 M...
31. What is mRNA? What is tRNA? 34. What is Tm for a DNA fragment? What are those factors that affect Tm?!
Fill in the blanks regarding DNA hybridization (5 marks): a. Increasing temperature towards the Tm duplex hybridization. b. Adding organic solvent to a sample of hybridized dsDNA temperature Doubling the amount of dsDNA in a sample 1. the stringency of DNA the melting the Tm and C. the A260 value d. If A250 1.0 in a dsDNA sample under standard conditions, and then the sample is incubated at its Tm, the A2s0 Value will A260 change by? BONUS: what percentage...
When the ds DNA is heated to 100 C, the two strands separate. Depending on the conditions, when the solution is cooled, the two strands can find each other and re-form the double helix. If the DNA on left hand is heated to 100 C and then cooled. What may be the structure of the single strands if the two strands NEVER find one another? GCGCGCGCGCGCGCGC CGCGCGCGCGCGCGCG
1060 steel heated to ? region slowly cool to just above eutectoid temperature. What phases/structures are present? What is the expected hardness, BHN for the 1060 steel after (OQ, AC and WQ)?
THANK YOU!! Target Region Heated to 94°C DNA is denatured GGGCAACGTG CATCACTTTG Primers hybridize with template Temperature is lowered After one round of PCR the number of double-stranded DNA molecules is doubled. TGG TCACTTTGGCAAIAGAATT Heat-stable DNA polymerase adds nucleotides to the 3' end of the primer Primer 1 Primer 2 Heated to 72°C 5 TGCCTGGCCCCATCACTTTGGCAA AGAATTC 5
A solution of NaCl(aq) is added slowly to a solution of lead nitrate, Pb(NO), (aq), until no further precipitation occurs. The precipitate is collected by filtration, dried, and weighed. A total of 14.12 g PbCI,(s) is obtained from 200.0 mL of the original solution Calculate the molarity of the Pb(NO), (aq) solution. concentration:
M. Solid potassium sulfide is slowly added to 50.0 mL of a silver acetate solution until the concentration of sulfide ion is 0.0260 M. The maximum amount of silver ion remaining in solution is M. Solid potassium sulfide is slowly added to 50.0 mL of a silver acetate solution until the concentration of sulfide ion is 0.0260 M. The maximum amount of silver ion remaining in solution is