Answer-
According to the given question-
Polymerase chain reaction- Polymerase chain reaction is used for getting the large quantity of DNA in pure form from the single copy in a very short period of time with the help of specific enzymes.
According to the information given in the sample we have 3600 copies of DNA fragment and we have to calculate the number of copies after 45 cycles of polymerase chain reaction.
we know that DNA have two strand and both strand serve as template strand during synthesis. so from one molecule of double strand DNA we get two copy of double strand DNA molecule or in other word we can say that from one DNA strand we get one more DNA strand.
For example if we have 1 DNA molecule that have two strand so after one cycle of PCR we get 2 DNA molecule or 4 DNA strand or fragment or copy of DNA that can be used for the next cycle of PCR.
So considering the same information for this question also here we have 3600 fragment of DNA which means we have 3600 DNA strand or 1800 DNA molecule .
so from one DNA molecule after one PCR cycle we get 2 copy of DNA thus for n number of cycle we get= 2 (n) copy of DNA
so putting the valve in this equation we get number of copy.
number of copy from 3600 fragment of DNA or 1800 DNA molecule=
1800
2 (45)
= 3600 (45)
number of copy from 3600 fragment of DNA or 1800 DNA molecule = 1 * 10^ 160 copy of DNA
Beginning with 3600 copies of a DNA fragment, calculate the number of copies after 45 cycles...
Suppose you start a PCR reaction with 3 copies of a double stranded DNA fragment. How many copies will be present after 4 replication cycles? a. 7 b. 64 c. 48 d. 24 e. 8
PCR Question: after 25 cycles in the thermometer, the DNA template is amplified to _____ copies. Choices a) 25 to the power of 2 b) over 100,000 c) over a million d) over 33 million
You determine that you have only three copies left of an important DNA fragment, so you decide to amplify it. Using flanking primers, how many PCR cycles would you have to run to generate over one billion (109) copies of the fragment? I know the answer is 29. I just don't understand how to get that answer.
A PCR reaction begins with 5 double stranded segment(s) of DNA. Part A: Estimate the number of double-stranded copies of DNA that are present after the completion of 15 amplification cycles? Part B: After 30 cycles?
You want to generate billions of copies of a DNA fragment
(sequence) consisting of ONLY the bracketed sequence in the DNA
molecule below. Even though in “real life” we use primers around 20
bases long, let’s suppose for this example that 3 base long primers
will work successfully. Which of the following primers will work to
generate your PCR amplicon (DNA fragment)?
5'-AATGAGCCATC[CCATATAAGCCGCGAGTTTG CATGTAC---3' O 5'CCA3' alone O 5'CCA3' and 5'CAA3' O 5'TGG3' and 5'TTG3' O S'ATC3' and 5'TAC3' O...
2. PCR amplification of the TAS2R38 gene a. The number of copies of the 303 bp sequence grows exponentially (1-2-4-8-etc) after each cycle. The number of cycles we used is on page 97. What is the number of copies of the 303 bp fragment that will theoretically be present at the end of our reaction? b. Denaturation of the 303 bp segment of the TAS2R38 gene is a critical first step in the PCR perties of a DNA segment that...
1.The PCR (polymerase chain reaction) protocol that is currently
used in laboratories was facilitated by the discovery of a
bacterium called Thermus aquaticus in a hot spring inside
Yellowstone National Park, in Wyoming. This organism contains a
heat-stable form of DNA polymerase known as Taq
polymerase, which continues to function even after it has been
heated to 95°C.
a.Why would such a heat-stable polymerase be beneficial in
PCR?
b.What would happen if it weren’t
heat stable?
c.How might you choose...
If you start with 47 DNA segments, how many total copies of DNA will you have after 12 cycles of PCR? Also what does attenuated mean in regards to the K12 strain of E. coli being used in lab? Is the answer “we have removed the gene that allows the bacteria to replicate”? Thank you!!
polymerase chain reaction, many copies of regions of the genome for a number of different downstream applications. In this Project you are PCR-amplifying your mitochondrial HVR1 region so that you can obtain the DNA sequence for that region. The ultimate goal is to determine your haplotype or haplogroup based on that region, which will provide you with insight into your deep ancestry. consider the class discussions you had on PcR this week. Use this information to answer the following questions:...
How are copies of a DNA amplicon made after the amplicon inserted into a cloning vector?