write the sequence of the GFP and primer DNAs, showing each of the primers annealed to...
write the sequence of the GFP and primer DNAs, showing each of the primers annealed to its complementary sequence in the target (EGFP) DNA. Label the 5’ and 3’ ends of all DNA strands.
Homework Answers
GFP is Green Fluorescent Protein.
F: 5' - CTGGTCGAGCTGGACGGCGACG-3'
R: 5' - CACGAACTCCAGCAGGACCATG -3'
A primer is a short nucleic acid sequence that provides a starting point for DNA synthesis. In living organisms, primers are short strand of RNA. A primer has to be synthesised by an enzyme called primase. the synthesis of a primer is of utmost necessity because DNA polymerase which is an enzyme that synthesises DNA , can only attach a DNA nucleotide to an existing strand of nucleotide. A nucleotide consists of a 5 carbon pentose or rtibose sugar, a nitrogeneous base and a phosphate group.
Add Answer to:
write the sequence of the GFP and primer DNAs, showing each of
the primers annealed to...
S-CGT-3 GTG 3. Write in the following sequences to depict them hybridizing/annealing to complementary and antiparallel...
S-CGT-3 GTG 3. Write in the following sequences to depict them hybridizing/annealing to complementary and antiparallel sequence in the exposed nucleotide chains. 5'-GTG-3 5-CGT-3 5'-ACG-3' | 5 -CAC-3" 5'-AAT[CGTATCAGCAGCAGTG|ACT-3 -3'-TTALGCATAGTCGTCGTCATGA-5'- 3. Two of the four above sequences can be used together as a "primer pair" to PCR amplify the bracketed sequence. In order to determine which two will work, recall that new polynucleotide chains can only be added to on the 3'end. Draw an arrow from the 3' end of...
To do the PCR, we used 2 universal primers that roughly match sequences near the 5’...
To do the PCR, we used 2 universal primers that roughly match sequences near the 5’ and 3’ ends of the 16S rRNA gene. The forward primer binds near the 5’ end to the complementary strand of the sequences shown below. The sequence of the forward primer is: Agagtttgatcctggctcag The reverse primer binds near the 3’ end to the sequences shown below. The sequence of the reverse primer is: ACGGCTACCTTGTTACGACTTG To find the primer in the sequence below, you must...
Now. you should be able to answer the following questions: • How the amplification will be...
Now. you should be able to answer the following questions: • How the amplification will be done? - How you will determine your target sequence? How the amplification will be specific for certain segment? What are the requirements to carry PCR? • Suppose you perform a PCR that begins with one double-strand of the following DNA template: +5'-CTACCTGCGGGTTGACTGCTACCTTCCCGGGATGCCCAAAATTCTCGAG-3+ +3'-GATGGACGCCCAACTGACGATGGAAGGGCCCTACGGGTTTTAAGAGCTC-5'+ A. Draw one cycle of PCR reaction below the following diagram. B. Label the template DNA, the primers, and what is...
CHAPTER 14: Identify the primer sequences that could be used in this PCR reaction shown below...
CHAPTER 14: Identify the primer sequences that could be used in this PCR reaction shown below to amplify the target region highlighter in pink (which could be an important gene such as insulin that you want to make many copies of). At this point, the double-stranded DNA has been heated so that the strands are now in a single-strand formation. Be sure to pay attention to the DNA sequence and the 5' 3'ends of the primers. 5' GG CCA A...
Which of the following is NOT a reason that each PCR Primer requires a different PCR...
Which of the following is NOT a reason that each PCR Primer requires a different PCR settings? -because the complimentary strands of the DNA may be composed of more G-C pairs which would require less energy to denature than a strand with more A-T pairs due to the amounts of hydrogen bonds to break in each. -because the PCR products are different lengths which may require different amounts of time to denature, elongate , and extend the PCR...
This PCR step is called annealing. The annealing step follows the denaturation step: it is usually...
This PCR step is called annealing. The annealing step follows the denaturation step: it is usually the lowest temperature in the PCR. The temperature of this step varies with each PCR reaction because each primer has its own sequence and may not be an identical match to the DNA template strand. GC or CG have three hydrogen bonds and AT or TA have two hydrogen bonds. Higher annealing temperatures are more stringent and require a better match between primer and...
3. The partial gene (DNA) sequence below contains multiple PAM sequences. Highlight six PAM sequences in...
3. The partial gene (DNA) sequence below contains multiple PAM sequences. Highlight six PAM sequences in the top (5' to 3) strand. 5'-GCACGGCGGAGCGGTTCTTGGCAGCGGCCGCACGATCTCGTTGCCGCCGG- 3' 3-CGTGCCGCCTCGCCAAGAACCGTCGCCGGCGTGCTAGAGCAACGGCGGCC- 5' Once Cas9 binds to a PAM sequence, it unwinds the DNA. If the guide RNA matches the DNA sequence next to the PAM, the guide RNA will bind to the complementary DNA strand. If not, the DNA will zip back together and Cas9 will keep binding to other PAM sequences until it finds the...
Write the base sequence of the complementary strand... (Please explain! thank you) 8. Base Sequence of...
Write the base sequence of the complementary strand... (Please
explain! thank you)
8. Base Sequence of Complementary DNA Strands Write the base sequence of the complementary strand (from 5' to 3') for the following one strand of a double-helical DNA, and then identify Palindrome sequence(s) or Mirror repeat sequence(s). i) 5'- GCGCAATATTTCTAGAAATATTGCGC - 3' ii) 5'-TTAGCACGTGCTAA-3' iii) 5'-TTAGCACCACGATT-3'
pls help The DNA sequence below is 300 bases long. This is only one strand of...
pls help
The DNA sequence below is 300 bases long. This is only one strand of DNA going from 5' starting at base 1081 to 3' ending at base 1380. The complementary strand is NOT shown. The sequence is broken up into 10 base sections to make counting easier. Design primers to amplify a DNA fragment that is 150bps in length. 1081 cagtatcagg tggtggcccc ttgcccccag tcagcaccct gacatcactg cacagtctgt 1141 ctgcctcgcc tgctccccac catggactca toatgacctc cctgcccagc gtcatgagtc 1201 tgggagagtc ctctctcctc ataggtcaaa ccgtacctgt...
Design the two primers (6 nucleotides), and add an EcoR1 cut site to the forward primer...
Design the two primers (6 nucleotides), and add an EcoR1 cut site to the forward primer (the 6-letter sequence), and BamH1 cut site to the reverse primer. Look up the cut site sequence. Label the restriction enzyme cut sites and add two overhang bases. Cut sites are included in the Tm. 5’-CTATGAGGTCCTGCGTTAGTGTTACC-3’ Forward: Tm: Reverse: Tm: Annealing temperature:
S-CGT-3 GTG 3. Write in the following sequences to depict them hybridizing/annealing to complementary and antiparallel sequence in the exposed nucleotide chains. 5'-GTG-3 5-CGT-3 5'-ACG-3' | 5 -CAC-3" 5'-AAT[CGTATCAGCAGCAGTG|ACT-3 -3'-TTALGCATAGTCGTCGTCATGA-5'- 3. Two of the four above sequences can be used together as a "primer pair" to PCR amplify the bracketed sequence. In order to determine which two will work, recall that new polynucleotide chains can only be added to on the 3'end. Draw an arrow from the 3' end of...
Now. you should be able to answer the following questions: • How the amplification will be done? - How you will determine your target sequence? How the amplification will be specific for certain segment? What are the requirements to carry PCR? • Suppose you perform a PCR that begins with one double-strand of the following DNA template: +5'-CTACCTGCGGGTTGACTGCTACCTTCCCGGGATGCCCAAAATTCTCGAG-3+ +3'-GATGGACGCCCAACTGACGATGGAAGGGCCCTACGGGTTTTAAGAGCTC-5'+ A. Draw one cycle of PCR reaction below the following diagram. B. Label the template DNA, the primers, and what is...
CHAPTER 14: Identify the primer sequences that could be used in this PCR reaction shown below to amplify the target region highlighter in pink (which could be an important gene such as insulin that you want to make many copies of). At this point, the double-stranded DNA has been heated so that the strands are now in a single-strand formation. Be sure to pay attention to the DNA sequence and the 5' 3'ends of the primers. 5' GG CCA A...
This PCR step is called annealing. The annealing step follows the denaturation step: it is usually the lowest temperature in the PCR. The temperature of this step varies with each PCR reaction because each primer has its own sequence and may not be an identical match to the DNA template strand. GC or CG have three hydrogen bonds and AT or TA have two hydrogen bonds. Higher annealing temperatures are more stringent and require a better match between primer and...
3. The partial gene (DNA) sequence below contains multiple PAM sequences. Highlight six PAM sequences in the top (5' to 3) strand. 5'-GCACGGCGGAGCGGTTCTTGGCAGCGGCCGCACGATCTCGTTGCCGCCGG- 3' 3-CGTGCCGCCTCGCCAAGAACCGTCGCCGGCGTGCTAGAGCAACGGCGGCC- 5' Once Cas9 binds to a PAM sequence, it unwinds the DNA. If the guide RNA matches the DNA sequence next to the PAM, the guide RNA will bind to the complementary DNA strand. If not, the DNA will zip back together and Cas9 will keep binding to other PAM sequences until it finds the...
Write the base sequence of the complementary strand... (Please
explain! thank you)
8. Base Sequence of Complementary DNA Strands Write the base sequence of the complementary strand (from 5' to 3') for the following one strand of a double-helical DNA, and then identify Palindrome sequence(s) or Mirror repeat sequence(s). i) 5'- GCGCAATATTTCTAGAAATATTGCGC - 3' ii) 5'-TTAGCACGTGCTAA-3' iii) 5'-TTAGCACCACGATT-3'
pls help
The DNA sequence below is 300 bases long. This is only one strand of DNA going from 5' starting at base 1081 to 3' ending at base 1380. The complementary strand is NOT shown. The sequence is broken up into 10 base sections to make counting easier. Design primers to amplify a DNA fragment that is 150bps in length. 1081 cagtatcagg tggtggcccc ttgcccccag tcagcaccct gacatcactg cacagtctgt 1141 ctgcctcgcc tgctccccac catggactca toatgacctc cctgcccagc gtcatgagtc 1201 tgggagagtc ctctctcctc ataggtcaaa ccgtacctgt...
Most questions answered within 3 hours.
-
An object is located 7.10 cm in front of a mirror. The virtual
image is located...
asked 38 minutes ago -
Write a program in python that lets the user play the game Rock,
Paper, Scissors against...
asked 1 hour ago -
A car starts from rest on a curve with a radius of 150 m and
tangential...
asked 4 hours ago -
In Star Wars both the Storm Troopers and Droid Army are
notoriously bad shots. In order...
asked 7 hours ago -
when buffers react with h+ or oh-, do the ratio of conjugate
base to acid and...
asked 7 hours ago -
A population of values has a normal distribution with μ=207.3
and σ=35.8. A random sample of...
asked 7 hours ago -
An unknown solution was treated with H2SO4 and refluxed for 2
hours. The mixture was then...
asked 7 hours ago -
Let x be the age of a licensed driver in years. Let
y be the percentage...
asked 8 hours ago -
System.out.print( "Barrel\t"+"of"+"Laughs" );
asked 9 hours ago -
Need a 1,000 word self explanatory essay on how
characteristics of the functional, matrix & bureaucracy...
asked 9 hours ago -
(Could you explain how I can answer the question and what the
equation I will use)....
asked 9 hours ago -
The ΔGf0 values for HCO3- (aq),
CO32-(aq), and H+(aq) are -587.06,
-528.10 and 0 kJ mol-1,...
asked 9 hours ago