You have purified a sample of your protein of interest and have measured the A280 of a 1 in 3 dilution of the protein sample (1 cm pathlength). The value you have obtained for A280 was 0.576. Given th...
You have purified a sample of your protein of interest and have measured the A280 of a 1 in 3 dilution of the protein sample (1 cm pathlength). The value you have obtained for A280 was 0.576. Given that you do not know the sequence of your protein, calculate the approximate concentration of your original protein sample in mg/mL. Give your answer to 2 s.f.
Homework Answers
As a reference, a protein solution of concentration 1mg/ml produces an absorbance of 1 unit at 280nm.
Hence the conecntration of protein with absorbance (A280), of 0.576 = 1 X 0.576 = 0.576mg/ml
Since the sample is diluted in 1:3 ratio.
Therefore, the concentration of undiluted sample will be, 0.576 X 3 = 1.728mg/ml
Add Answer to:
You have purified a sample of your protein of interest and have measured the A280 of a 1 in 3 dilution of the protein sample (1 cm pathlength). The value you have obtained for A280 was 0.576. Given th...
You have isolated a sequence of double stranded DNA with the sequence below. The A260 (1 cm pathlength) of a 1 in 100 dilution of this sample is 0.64. Give the concentration of your sample in μM. Giv...
You have isolated a sequence of double stranded DNA with the sequence below. The A260 (1 cm pathlength) of a 1 in 100 dilution of this sample is 0.64. Give the concentration of your sample in μM. Give your answer to 3sf. GAGATACCAGATAGACACCAGATTGACACAGTAGACACAGATACATAGACAAACCCAGGATAGGGACATACCCAAAATT
1. You have been given a sample that is a 1/50 dilution of the original. You...
1. You have been given a sample that is a 1/50 dilution of the original. You measure 3.4 mg glucose in 0.5 ml of that sample. What is the concentration in the original sample? If you have 400 ml of that sample, how many grams of glucose is in the total sample?
You have obtained 150 µL of a protein sample of which you want to perform a...
You have obtained 150 µL of a protein sample of which you want to perform a Bradford Assay. You perform a 10-fold dilution of your sample and use 10 µl of this dilution to quantify the amount of protein using a Bradford assay. You obtain an absorbance value of 0.63. Using the standard curve and equation you obtained in class, determine the concentration of protein (µg/µL) of your original sample. Show your work. equation: y=0.0139x-0.0153
11. From the table in question 10, describe a general technique for separating histidine from a...
11. From the table in question 10, describe a general technique for separating histidine from a mixture of His, Tyr, and Arg using an anion exchange media. At what pH would you equilibrate the column? At what pH would each amino acid elute? charged group 12. Compare the dye-binding protein concentration assays, Bradford and BCA in terms of accuracy and ease-of-use. The dyes bind to different areas of the protein. How does this impact their accuracy? How can you improve...
Lab 5: Additional Dilution Problems You have a stock solution that contains 24 mg/ml of protein....
Lab 5: Additional Dilution Problems You have a stock solution that contains 24 mg/ml of protein. You want to make a set of standards with the following concentrations: 12 mg/ml, 6 mg/ml, 3 mg/ml and 1.5 mg/ml You need a minimum of 500 ul of each standard after all dilutions are completed. Using the technique of serial dilution, explain how you would make your standards by filling in the chart below. Std 4 Std 1 12 Std 2 6 Std...
1. You want to prepare a 1:50 dilution of your protein extract in a total volume...
1. You want to prepare a 1:50 dilution of your protein extract in a total volume of 1000 uL. You will need ___ uL of protein extract and ___ uL of water. 2. You are provided with a solution of BSA that is 100 ug/mL and make a 10-2 dilution? What is the resulting concentration of the DILUTED BSA? 3. Which of the following statements about enzymes is true? Select one: a. Enzymes increase the rate of a chemical reaction...
1. Make a 10 fold serial dilution of a protein to achieve a final concentration of...
1. Make a 10 fold serial dilution of a protein to achieve a final concentration of 10ug/ml You are staring from a 10 mg/ml protein stock. Indicate the amount of sample needed (from previous tube) and the amount of H20 needed. Make your calculations for 100μ1 volume. (0.5pts) 10ul 90μ1 H20 10mg/ml lmg/ml
A. You have been given a tube of E. coli. You are asked to make 1...
A. You have been given a tube of E. coli. You are asked to make 1 mL total volume of 10-1 dilution of the bacterial culture. Explain how you would do this. Show all necessary calculations. ____ ml cells + _____ ml water = 1 ml (total volume) B. Next, you were asked to make a 10-2 dilution of the bacterial sample. Explain how you would perform this. Show all necessary calculations. You have bacteria at a concentration of 2...
Need help please SOLUTION MAKING in water. Calculate the amount of NaCl you need to weigh...
Need help please
SOLUTION MAKING in water. Calculate the amount of NaCl you need to weigh out. 1 (a). You need 500mL of 15% (w/v) NaCl 1(b) What approximate volume of water would you dissolve the NaCl in? Please give a range of volumes. 1(c). Assuming that adding the NaCI to your original volume of water caused the volume to increase by 50mL before you added additional water to reach your final volume, what is the DENSITY of your final...
4) You have been given the job of designing an experiment to test the effects of...
4) You have been given the job of designing an experiment to test the effects of an inhibitor on the coronavirus polymerase. Assume you have a stock solution containing purified polymerase protein. You want to know how much polymerase protein you have in the stock solution. To do this, you will use the Bradford Assay. If you mix 50L of polymerase protein stock solution with 100L of water, perform the Bradford Assays and get a resulting OD 595mm of 0.6,...
11. From the table in question 10, describe a general technique for separating histidine from a mixture of His, Tyr, and Arg using an anion exchange media. At what pH would you equilibrate the column? At what pH would each amino acid elute? charged group 12. Compare the dye-binding protein concentration assays, Bradford and BCA in terms of accuracy and ease-of-use. The dyes bind to different areas of the protein. How does this impact their accuracy? How can you improve...
Lab 5: Additional Dilution Problems You have a stock solution that contains 24 mg/ml of protein. You want to make a set of standards with the following concentrations: 12 mg/ml, 6 mg/ml, 3 mg/ml and 1.5 mg/ml You need a minimum of 500 ul of each standard after all dilutions are completed. Using the technique of serial dilution, explain how you would make your standards by filling in the chart below. Std 4 Std 1 12 Std 2 6 Std...
1. Make a 10 fold serial dilution of a protein to achieve a final concentration of 10ug/ml You are staring from a 10 mg/ml protein stock. Indicate the amount of sample needed (from previous tube) and the amount of H20 needed. Make your calculations for 100μ1 volume. (0.5pts) 10ul 90μ1 H20 10mg/ml lmg/ml
Need help please
SOLUTION MAKING in water. Calculate the amount of NaCl you need to weigh out. 1 (a). You need 500mL of 15% (w/v) NaCl 1(b) What approximate volume of water would you dissolve the NaCl in? Please give a range of volumes. 1(c). Assuming that adding the NaCI to your original volume of water caused the volume to increase by 50mL before you added additional water to reach your final volume, what is the DENSITY of your final...
4) You have been given the job of designing an experiment to test the effects of an inhibitor on the coronavirus polymerase. Assume you have a stock solution containing purified polymerase protein. You want to know how much polymerase protein you have in the stock solution. To do this, you will use the Bradford Assay. If you mix 50L of polymerase protein stock solution with 100L of water, perform the Bradford Assays and get a resulting OD 595mm of 0.6,...
Most questions answered within 3 hours.
-
Free content. Free software. Freemium pricing models. Viral
popularity. Disappearing gatekeepers. These are the disrupters of...
asked 24 minutes ago -
Consider the simple linear regression model: HARD1 =
β0 + β1*SCORE + є, where
є ~...
asked 1 hour ago -
In the Chesapeake region during the mid-17th
century how similar was the experience of an independent...
asked 3 hours ago -
. A 2.50 M stock solution was used to prepare a dilute NaOH
solution with a...
asked 4 hours ago -
Write a program that reads in a text file, infile.txt, and
prints out all the lines...
asked 6 hours ago -
Which of the following orbits have a total of zero energy (based
on the common convention)?...
asked 6 hours ago -
Find the expected count and the contribution to the chi-square
statistic for the (Group 1, No)...
asked 8 hours ago -
Suppose you are purchasing a meal and with every meal a you
receive one of 10...
asked 8 hours ago -
A 75.0 kg 0erson is riding in a car moving at 20.0 m/s when the
car...
asked 8 hours ago -
What does Δp = QR mean in words?
Pushing a viscous fluid through a pipe requires...
asked 8 hours ago -
We know that system.out.println (“object number” + n ); is
legal.String name; int n; name =...
asked 8 hours ago -
Come up with a real-life problem (open-ended) and solve it by
designing and writing a Java...
asked 8 hours ago