The FMR1 gene contains a trinucleotide CGG repeat. A schematic of the first exon at the 5’ end of the gene is shown belo...
The FMR1 gene contains a trinucleotide CGG repeat. A schematic of the first exon at the 5’ end of the gene is shown below, with the transcription start site (TSS) and translational start site (AUG codon) marked. The location of the CGG repeat is indicated as well. The length of the CGG repeat affects the ____________ sequence. (Select all that apply.)
1. mature mRNA
2.primary RNA
3.protein
4. DNA
Homework Answers
FMR1 IS Fragile X mental retardation gene 1 . Fragile site of X chromosome contains CGG repeat in the 5th untranslated region of the genes . This trinucleotide repeat is unstable and therefore the repeat length is variable. The mutation of the CGG repeat affects the DNA as it causes methylation of DNA . The length of the CGG repeat affects the DNA sequence .
Add Answer to:
The FMR1 gene contains a trinucleotide CGG repeat. A schematic of the first exon at the 5’ end of the gene is shown belo...
Below is the genomic DNA of gene X, a 3 exon gene that encodes a 131 amino acid single pass trans...
why is E the answer
Below is the genomic DNA of gene X, a 3 exon gene that encodes a 131 amino acid single pass transmembrane protein. Shown are the transcriptional start site, splice donor, acceptor and branch sites and translational start and stop codons. Transcriptional start EXON 1 INTRON 1 EXON 2 INTRON 2 EXON 3 Spfice Donor Splice Acceptor Polyadenylation signal Branch point 17. Treatment with ethidium bromide, an intercalating agent, caused DNA polymerase to add an extra...
Hemoglobin is a protein that is found in red blood cells. It binds to oxygen in...
Hemoglobin is a protein that is found in red blood cells. It binds to oxygen in the lungs and it carries it to tissues and cells throughout the body. Hemoglobin is made of four polypeptide chains, two called “alpha-globins” (a) and two “beta-globins" (B). The B-globin polypeptide is produced in the cells based on the sequence of the HBB gene. The structure of the HBB gene that codes for beta-globin is represented below. The primary transcript is 1606 nucleotides long....
Question 2. FOR A BACTERIAL GENE, writing left-to-right, show the relative positions of each of these...
Question 2. FOR A BACTERIAL GENE, writing left-to-right, show the relative positions of each of these genetic elements as they would appear in the DNA from upstream on the left to downstream on the right. Of course, some of these genetic elements will only be active once they are in mRNA (e.g., the translational start codon), but they are still found encoded in the sequence of DNA. RBS ribosome binding site UAA translational stop site (UAA) TSS transcriptional start site...
1. EORA BACTERIAL GENE, writing left-to-right, show the relative positions of each of these genetic elements...
1. EORA BACTERIAL GENE, writing left-to-right, show the relative positions of each of these genetic elements as they would appear in the DNA from upstream on the left to downstream on the right. Of course, some of these genetic elements will only be active once they are in mRNA (e.g., the translational start codon), but they are still found encoded in the sequence of DNA onthe left the translational start colon . but they are s RBS ribosome binding site...
3of 3 9. The figure below represents the primary transcript of a gene that contains four exons (A, B, C, D) and two introns. The dark block in exon B indicates the position of an additional stop...
3of 3 9. The figure below represents the primary transcript of a gene that contains four exons (A, B, C, D) and two introns. The dark block in exon B indicates the position of an additional stop codon; the normal start and stop codons for translation are present in exons A and D respectively. The two arrows indicate alternative 3' splice sites for the first intron Pre-mRNA 5'I 3' intron intron Give a schematic representation of the mature mRNAs that...
Below is a schematic of gene Hemoglobin beta subunit (HBS), which encodes protein HBS. The promoter...
Below is a schematic of gene Hemoglobin beta subunit (HBS), which
encodes protein HBS. The promoter region is indicated by the dotted
box. Transcriptions begins immediately following the promoter. The
mature mRNA produced by this gene would be approximately how many
nucleotides long?
A) 100
B) 200
C) 3000
D) 5000
E) 7000
1. Below is a schematic of gene Hemoglobin beta subunit (HBS), which encodes protein HBS. The promoter region is indicated by the dotted box. Transcription begins immediately...
Draw a Eukaryotic Gene Schematic Draw features of importance at the DNA level Transcription start site...
Draw a Eukaryotic Gene Schematic Draw features of importance at the DNA level Transcription start site +1 Promoter - as much detail as you can Gene start ATG and stop codons Transcription Regulatory Sequences such as activators/repressors and enhancers/insulators Draw features of importance at the pre-mRNA level Designate Introns and Exons Designate important Sequences to direct and regulate splicing three important sequences for the chemistry of splicing splicing regulatory sequences (ISS, ISE, ESE, ESS) Modifications at level of pre-mRNA UTRs,...
Below is the DNA sequence of a protein-encoding Eukaryotic gene: 5’TAAACGCGATGGACCGACCATACAGTATCGACGCTCCAGGATGGTAAAATAAATGCCT3’ Based on this information, predict...
Below is the DNA sequence of a protein-encoding Eukaryotic gene: 5’TAAACGCGATGGACCGACCATACAGTATCGACGCTCCAGGATGGTAAAATAAATGCCT3’ Based on this information, predict the mature mRNA sequence and the corresponding peptide sequence of this gene after transcription, RNA processing, and translation. Try to recognize and label the sequence features on the primary transcript you learned from the class that are important for Eukaryotic mRNA Processing (e.g. intron sites, poly-A adding site). Please also briefly describe the key steps taking place during RNA processing. For each step of...
Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains...
Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains a start codon and could serve as the template for synthesis of an mRNA molecule. 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) a. Which strand will serve as the template strand for transcription? b. Based on the template strand you have chosen, write the mature mRNA sequence on your answer sheet in the 5’ to 3’ direction. Be sure to label 5’ and...
Background Information How can we predict where a coding gene will be in bacteria? And can...
Background Information How can we predict where a coding gene will be in bacteria? And can we then predict what protein will be produced? Take the DNA sequence below, for example. tcaggctttaattcatccgtgatctttgacgacggtaaatacgatgcagatataatacgatgaccgatgccaatcgaccgatcaaggaggcaccgaatggcgatgatggcgatgattgcgattaacgaagtggaacgcattatggcgggcattaacgaagatacccatgcgaccggcgaaaacgaaaccatttgcagctgcgcgaactttgaagaactgacccatgcgaccggccgcgaagcgacctaaaagtcgtaattacgtatcaagtcatgggccgcgggcgcccggcccactgactagactagggccgggcgcccgcggcccaccatataaataaaaaaaaaaaaaacgaggctatagctcatcaatgacct If you were a bacterial RNA polymerase, what sequence(s) should there be in this DNA for you to bind and begin transcribing? And if you found such sequence(s), where would you begin transcription? As a human being looking at this fragment of DNA, what type of consensus sequence(s)...
why is E the answer
Below is the genomic DNA of gene X, a 3 exon gene that encodes a 131 amino acid single pass transmembrane protein. Shown are the transcriptional start site, splice donor, acceptor and branch sites and translational start and stop codons. Transcriptional start EXON 1 INTRON 1 EXON 2 INTRON 2 EXON 3 Spfice Donor Splice Acceptor Polyadenylation signal Branch point 17. Treatment with ethidium bromide, an intercalating agent, caused DNA polymerase to add an extra...
Hemoglobin is a protein that is found in red blood cells. It binds to oxygen in the lungs and it carries it to tissues and cells throughout the body. Hemoglobin is made of four polypeptide chains, two called “alpha-globins” (a) and two “beta-globins" (B). The B-globin polypeptide is produced in the cells based on the sequence of the HBB gene. The structure of the HBB gene that codes for beta-globin is represented below. The primary transcript is 1606 nucleotides long....
Question 2. FOR A BACTERIAL GENE, writing left-to-right, show the relative positions of each of these genetic elements as they would appear in the DNA from upstream on the left to downstream on the right. Of course, some of these genetic elements will only be active once they are in mRNA (e.g., the translational start codon), but they are still found encoded in the sequence of DNA. RBS ribosome binding site UAA translational stop site (UAA) TSS transcriptional start site...
1. EORA BACTERIAL GENE, writing left-to-right, show the relative positions of each of these genetic elements as they would appear in the DNA from upstream on the left to downstream on the right. Of course, some of these genetic elements will only be active once they are in mRNA (e.g., the translational start codon), but they are still found encoded in the sequence of DNA onthe left the translational start colon . but they are s RBS ribosome binding site...
3of 3 9. The figure below represents the primary transcript of a gene that contains four exons (A, B, C, D) and two introns. The dark block in exon B indicates the position of an additional stop codon; the normal start and stop codons for translation are present in exons A and D respectively. The two arrows indicate alternative 3' splice sites for the first intron Pre-mRNA 5'I 3' intron intron Give a schematic representation of the mature mRNAs that...
Below is a schematic of gene Hemoglobin beta subunit (HBS), which
encodes protein HBS. The promoter region is indicated by the dotted
box. Transcriptions begins immediately following the promoter. The
mature mRNA produced by this gene would be approximately how many
nucleotides long?
A) 100
B) 200
C) 3000
D) 5000
E) 7000
1. Below is a schematic of gene Hemoglobin beta subunit (HBS), which encodes protein HBS. The promoter region is indicated by the dotted box. Transcription begins immediately...
Draw a Eukaryotic Gene Schematic Draw features of importance at the DNA level Transcription start site +1 Promoter - as much detail as you can Gene start ATG and stop codons Transcription Regulatory Sequences such as activators/repressors and enhancers/insulators Draw features of importance at the pre-mRNA level Designate Introns and Exons Designate important Sequences to direct and regulate splicing three important sequences for the chemistry of splicing splicing regulatory sequences (ISS, ISE, ESE, ESS) Modifications at level of pre-mRNA UTRs,...
Most questions answered within 3 hours.
-
Romeo wishes to throw a bouquet of flowers to Juliet, who is on
a second-story balcony,...
asked 8 minutes ago -
Why is QE a controversial monetary policy tool.
A. It may lead to excessive inflation.B. By...
asked 24 minutes ago -
A finite potential well has depth U0 = 2.78 eV . What is the
penetration distance...
asked 50 minutes ago -
1. The bus bars of a power station are in two sections A and B
separated...
asked 49 minutes ago -
Fiscal policy is the deliberate manipulation of taxes and
government spending to alter GDP, employment, inflation...
asked 1 hour ago -
evaluating an expression using only one digit and + and - as
operators ....3+5-1+7-5+8
-----------------------
stack...
asked 1 hour ago -
Two concentric current loops lie in the same plane. The smaller
loop has a radius of...
asked 2 hours ago -
1)Which of the following is an
important difference between qualified and nonqualified retirement
plans?
a. Qualified...
asked 2 hours ago -
What's the streaming business's problem on the
horizon?
asked 3 hours ago -
I need help with writing the conclusion for this online lab
report
Abstract
By testing the...
asked 3 hours ago -
For the reaction 1N2+3H2-----> 2NH3, would the reaction rate
trend be: delta[NH3]/ delta t = -2...
asked 4 hours ago -
Within your current/past organization, identify a problem/issue
and format a design to address same. You may...
asked 3 hours ago