A widely used method for calculating the annealing temperature for a primer used in PCR is 5 degrees below the Tm (°C), which is computed by the equation 81.5 + 0.41 × (%GC) – (675/N), where %GC is the percentage of GC nucleotides in the oligonucleotide and N is the length of the oligonucleotide. Notice from the formula that both the GC content and the length of the oligonucleotide are variables. Assuming you have the following oligonucleotide as a primer, compute the annealing temperature for PCR. What is the relationship between Tm (°C) and %GC? Why? (Note: In reality, this computation provides only a starting point for empirical determination of the most useful annealing temperature.)
5ʹ–TTGAAAATATTTCCCATTGCC–3ʹ
We need at least 10 more requests to produce the solution.
0 / 10 have requested this problem solution
The more requests, the faster the answer.