What are the four common core promoter elements for eukaryotic genes transcribed by RNA polymerase II?...
What are the four common core promoter elements for eukaryotic genes transcribed by RNA polymerase II? Must all of these elements be present in the promoter for transcription of every gene to occur? Explain
Homework Answers
The core promoter is the portion of proximal promoter that contains the transcription start sites. Short sequence are surrounded by transcription start sites . It contains a binding site for Rna polymerase I, RNA polymerase II and RNA polymerase III. The core promoter is transcription start sites TSS. The promoters contains a specific DNA sequence that are recognized by proteins known as transcription factors.. All these factors are important for transcription of every genes.
Add Answer to:
What are the four common core promoter elements for eukaryotic
genes transcribed by RNA polymerase II?...
State three characteristics of core promoter elements for RNA polymerase II transcribed genes
State three characteristics of core promoter elements for RNA polymerase II transcribed genes
Can someone please help me answer these questions. Thank you! Eukaryotic transcription signals a) This drawing shows the placements of the four main sequences of the eukaryotic core promoter for RNA...
Can someone please help me answer these questions. Thank
you!
Eukaryotic transcription signals
a) This drawing shows the placements of the four main sequences of
the eukaryotic core promoter for RNA polymerase II. Identify each
one and give a brief explanation
b) Which sequences are used in a DPE-driven promoter?
c) Which ones are used in a TATA-driven promoter?
d) Please draw and describe the steps as the transcription factors
work with eukaryotic RNA polymerase II to start transcription of...
Describe the structure and function of elements needed for transcription, including the promoter, RNA polymerase core...
Describe the structure and function of elements needed for transcription, including the promoter, RNA polymerase core enzyme and holoenzyme, sigma factor, and template and non-template (coding) strands of DNA. eukaryotes - . List major differences between transcription and RNA processing in bacteria and o What is coupled transcription/translation? o What is a polyribosome? Is it exclusive of bacterz - Discuss major components and events in RNA processing, in - Describe tRNA stru - Discuss mech cluding, introns and exons, splicing....
Suppose a mutation occurs in the gene encoding eukaryotic RNA polymerase I, II, or lll that...
Suppose a mutation occurs in the gene encoding eukaryotic RNA polymerase I, II, or lll that renders that polymerase non-functional. Match each RNA polymerase mutation with all of the cellular processes that it would disrupt. Mutation in eukaryotic RNA polymerase I Mutation in eukaryotic RNA polymerase II Mutation in eukaryotic RNA polymerase III pre-mRNA processing RNA synthesispre-mRNA synthesis RNAi-mediated gene regulation IRNA synthesis mRNA translation rRNA processing
4. A promoter for an E. coli gene that is transcribed by a s-70 RNA polymerase...
4. A promoter for an E. coli gene that is transcribed by a s-70 RNA polymerase has the following sequence: 30 -20 10 +1 5'GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA 3'CCGAAATGTGAAATACGAAGGCCGAGCATACAACACACCT The transcription start site +1) is identified. a. Identify the -10 and -35 sequences. How close are they to the consensus-10 and-35 sequences? b. What is the spacing between the -10 and the -35 sequences? How does this compare with the consensus spacing? C. The sequence of bases in a transcribed RNA is identical...
Which of the following is NOT a function of transcription that requires the activity from subunits...
Which of the following is NOT a function of transcription that requires the activity from subunits of the Core RNA Palymerase? a. RNA polymerase activity that base-pairs and polymerizes nucleotides to make mRNA. b. Helicase activity that unwinds the double-stranded DNA molecule for transcription c. Specific recognition of -35 box and -10 box sites in the promoter region. d. General binding that helps RNA polymerase loosely adhere to DNA, before Transcription begins. Oe. Trick Question. The Core RNA polymerase can...
Question 2a If the DNA template 5′- ATGGATGC -3′ is transcribed to RNA, the RNA would...
Question 2a If the DNA template 5′- ATGGATGC -3′ is transcribed to RNA, the RNA would be best described as... a. 3′- TACCTACG -5′. b. 5′- ATGGATGC -3′. c. 5′- AUGGAUGC -3′. d. 5′- UACCUACG -5′. e. 3′- UACCUACG -5′. Question 2b Which answer best summarizes how eukaryotic and bacterial RNA polymerases are different? a. Eukaryotes have several types of multimeric RNA polymerases, whereas bacteria only have one monomeric RNA polymerase. b. Eukaryotes have several types of RNA polymerases, one...
QUESTION 4 a variable distance Eukaryotic genes (G) are regulated by promotors (P) and enhancers (E)....
QUESTION 4 a variable distance Eukaryotic genes (G) are regulated by promotors (P) and enhancers (E). On a given chromosome, the most likely order for these three elements is a. G...PE b. P...EG C. PE...G d. E...GP . E...PG QUESTION 5 The promoter of a gene a. is located right next to the gene b. determines whether or not mRNA is transcribed from the gene c. is the binding site for RNA polymerase d. is a controlling region for a...
Question 14 Which of the following is a feature common to BOTH prokaryotes and eukaryotes? The...
Question 14 Which of the following is a feature common to BOTH prokaryotes and eukaryotes? The use of nucleosomes to condense DNA in the nucleus. The ability to translate an RNA before its transcription is complete. The ability to have multiple ribosomes on a single RNA for more efficient translation. The ability to start transcription at a 5'AUG sequence. o Question 15 A particular prokaryotic promoter contains only the region from-10 to-35. Which of the following is true? The RNA...
What are two differences between the core promoter and the regulatory promoter for RNA pol II...
What are two differences between the core promoter and the regulatory promoter for RNA pol II of eukaryotes?
Can someone please help me answer these questions. Thank
you!
Eukaryotic transcription signals
a) This drawing shows the placements of the four main sequences of
the eukaryotic core promoter for RNA polymerase II. Identify each
one and give a brief explanation
b) Which sequences are used in a DPE-driven promoter?
c) Which ones are used in a TATA-driven promoter?
d) Please draw and describe the steps as the transcription factors
work with eukaryotic RNA polymerase II to start transcription of...
Describe the structure and function of elements needed for transcription, including the promoter, RNA polymerase core enzyme and holoenzyme, sigma factor, and template and non-template (coding) strands of DNA. eukaryotes - . List major differences between transcription and RNA processing in bacteria and o What is coupled transcription/translation? o What is a polyribosome? Is it exclusive of bacterz - Discuss major components and events in RNA processing, in - Describe tRNA stru - Discuss mech cluding, introns and exons, splicing....
Suppose a mutation occurs in the gene encoding eukaryotic RNA polymerase I, II, or lll that renders that polymerase non-functional. Match each RNA polymerase mutation with all of the cellular processes that it would disrupt. Mutation in eukaryotic RNA polymerase I Mutation in eukaryotic RNA polymerase II Mutation in eukaryotic RNA polymerase III pre-mRNA processing RNA synthesispre-mRNA synthesis RNAi-mediated gene regulation IRNA synthesis mRNA translation rRNA processing
4. A promoter for an E. coli gene that is transcribed by a s-70 RNA polymerase has the following sequence: 30 -20 10 +1 5'GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA 3'CCGAAATGTGAAATACGAAGGCCGAGCATACAACACACCT The transcription start site +1) is identified. a. Identify the -10 and -35 sequences. How close are they to the consensus-10 and-35 sequences? b. What is the spacing between the -10 and the -35 sequences? How does this compare with the consensus spacing? C. The sequence of bases in a transcribed RNA is identical...
Which of the following is NOT a function of transcription that requires the activity from subunits of the Core RNA Palymerase? a. RNA polymerase activity that base-pairs and polymerizes nucleotides to make mRNA. b. Helicase activity that unwinds the double-stranded DNA molecule for transcription c. Specific recognition of -35 box and -10 box sites in the promoter region. d. General binding that helps RNA polymerase loosely adhere to DNA, before Transcription begins. Oe. Trick Question. The Core RNA polymerase can...
QUESTION 4 a variable distance Eukaryotic genes (G) are regulated by promotors (P) and enhancers (E). On a given chromosome, the most likely order for these three elements is a. G...PE b. P...EG C. PE...G d. E...GP . E...PG QUESTION 5 The promoter of a gene a. is located right next to the gene b. determines whether or not mRNA is transcribed from the gene c. is the binding site for RNA polymerase d. is a controlling region for a...
Question 14 Which of the following is a feature common to BOTH prokaryotes and eukaryotes? The use of nucleosomes to condense DNA in the nucleus. The ability to translate an RNA before its transcription is complete. The ability to have multiple ribosomes on a single RNA for more efficient translation. The ability to start transcription at a 5'AUG sequence. o Question 15 A particular prokaryotic promoter contains only the region from-10 to-35. Which of the following is true? The RNA...
Most questions answered within 3 hours.
-
(Expected rate of return and risk) Carter Inc. is evaluating a
security. Calculate the investment’s expected...
asked 2 hours ago -
What specific indicators can point to lack of progress for
African Americans in American society?
asked 3 hours ago -
1-The Electrons in a beam are moving at 2.7×108 m/s in an
electric field of 15000...
asked 3 hours ago -
A gas tank is a vertical cylinder. It has a radius of 1m, a
height of...
asked 4 hours ago -
Accent Software faces the following conditions. All of these
support Accent’s use of a market-penetration pricing...
asked 5 hours ago -
A mathematically inclined friend emails you the following
instructions: "Meet me in the cafeteria the first...
asked 5 hours ago -
A monopoly sells in two countries . The demand curves in the two
countries are p1...
asked 6 hours ago -
A .15kg rubber ball is bounced off a wall. Before hitting the
wall, the ball moves...
asked 6 hours ago -
A manufacturing company preparing to build a new plant is
considering three potential locations for it....
asked 6 hours ago -
B. If compound Y has approximately the same values of solubility
in toluene as compound X,...
asked 7 hours ago -
Oscar Inc. has inventory in Japan valued at 39,051,000 Yen one
year ago. One year ago...
asked 7 hours ago -
If Canada suffered from "fundamental disequilibrium," and its
government choose not to devalue its currency, a...
asked 7 hours ago