State three characteristics of core promoter elements for RNA polymerase II transcribed genes
Eukaryotes possess three types of RNA polymerase: RNA Pol I, RNA Pol II and RNA Pol III.
Among them, RNA Pol II is responsible for the sythesis of mRNA (messenger RNA) and most of the snRNA (small nuclear RNA).
RNA Pol II core promoter has many characteristic features, three of them are listed below:
(1) Core promoters of RNA Pol II has three major elements: TATA Box, Inr sequence and DPE (Downstream promoter element). Presence of DPE suggest extension of core promoter downstream of the transcription start site.
(2) Most of the RNA Pol II core promoters are of two types: Promoters containing TATA box and TATA-less promoters.
Core Promoters containing TATA-Box has two elements: TATA box (at -25 position i.e., 25 base pairs upstream of the transcription start site (TSS)) and Inr (Initiator) sequence (spans between -3 to +5 position i.e., from 3 base pair upstream to 5 base pair downstream of transcription start site).
TATA-less core promoters has Inr sequence and DPE (present at +28 to +32 in the transcription unit.)
(3) As RNA Pol II does not have the ability to directly read DNA and bind. therefore, Core promoter elements have binding sites for general transcription factors (also called as basal transcription factors and expressed by symbol TFII X ) which are required to initiate transcription.
RNA Pol II core promoters have low efficiency and therefore also require some activators (another class of transcription factors that bind to proximal promoter) in order to maintain good level of transcription rate.
State three characteristics of core promoter elements for RNA polymerase II transcribed genes
What are the four common core promoter elements for eukaryotic genes transcribed by RNA polymerase II? Must all of these elements be present in the promoter for transcription of every gene to occur? Explain
Describe the structure and function of elements needed for transcription, including the promoter, RNA polymerase core enzyme and holoenzyme, sigma factor, and template and non-template (coding) strands of DNA. eukaryotes - . List major differences between transcription and RNA processing in bacteria and o What is coupled transcription/translation? o What is a polyribosome? Is it exclusive of bacterz - Discuss major components and events in RNA processing, in - Describe tRNA stru - Discuss mech cluding, introns and exons, splicing....
What are two differences between the core promoter and the regulatory promoter for RNA pol II of eukaryotes?
4. A promoter for an E. coli gene that is transcribed by a s-70 RNA polymerase has the following sequence: 30 -20 10 +1 5'GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA 3'CCGAAATGTGAAATACGAAGGCCGAGCATACAACACACCT The transcription start site +1) is identified. a. Identify the -10 and -35 sequences. How close are they to the consensus-10 and-35 sequences? b. What is the spacing between the -10 and the -35 sequences? How does this compare with the consensus spacing? C. The sequence of bases in a transcribed RNA is identical...
The gene in the diagram is transcribed by RNA polymerase from left to right. If the primary transcript in the diagram has the sequence 5' AAAAGGGGGGAUGGGG...3, the DNA strand with the sequence 5' AAAAGGGGGGATGGGG....3' would be found in the DNA strand labeled transcribed region promoter W exon intron exorn primary transcriptS
Which enzyme in eukaryotes is responsible for the transcription of most ribosomal RNA genes? RNA Polymerase I RNA Polymerase II RNA Polymerase III alpha polymerase
Why are related genes transcribed together? Why is transcription regulated? RNA Polymerase does not have proofreading mechanism and the error rate is 1 per 104~105, why is fidelity not as important as during DNA replication? Which RNAs are not translated to proteins?
Can someone please help me answer these questions. Thank you! Eukaryotic transcription signals a) This drawing shows the placements of the four main sequences of the eukaryotic core promoter for RNA polymerase II. Identify each one and give a brief explanation b) Which sequences are used in a DPE-driven promoter? c) Which ones are used in a TATA-driven promoter? d) Please draw and describe the steps as the transcription factors work with eukaryotic RNA polymerase II to start transcription of...
Why does E. coli have several different sigma factors? A.They allow RNA polymerase I, RNA polymerase II and RNA polymerase III to bind to different promoters. B.They allow the different subunits of the RNA polymerase holoenzyme to bind to each other. C.They are redundant in case one is mutated. They all perform the same function. D.One is needed to transcribe mRNA. A second is needed to transcribe tRNA. And a third is needed to transcribe rRNA. E.They are used if...
Answer the questions: Question 11 Recognition/binding site of RNA polymerase is called a Receptorb. Promoter . Facilitatord. Terminator Question 12 .A specific factor helps RNA polymerase binding to promoters and transcribe genes a Delta b. Beta Gamma d. Sigma Question 13 ............ Promoters lack a TATA box are referred to as TATA less promoters, for example operon Housekeeping genes b. Functional genesc d. Structural genes Question 14 0.5 points Save Answer During "RNA processing" All of the exons are a....