Any change in the normal nucleotide sequence that codes for an amino acid is called a...

Question

Question

Any change in the normal nucleotide sequence that codes for an amino acid is called a ___________________________________.

a.transcription

b.protein synthesis

c.mutation

d.replication

e.translation

Answer 1

Answer #1

inge in the normal Mecleotide Sequence that codes that an amino acide -called and translafiona Translate is a tool which allo

Answer 2

Similar Homework Help Questions

Which mutation has a change in the DNA sequence but no change in the amino acid sequence?

Question 12 Which mutation has a change in the DNA sequence but no change in the amino acid sequence? Question 4 Match the nucleotide pictures to their names.
Question 8 4 pts After a single base pair change, the following amino acid sequence was...

Question 8 4 pts After a single base pair change, the following amino acid sequence was altered. Original amino acid sequence: Met-Glu-Tyr-Leu-Phe Altered amino acid sequence: Met-Glu-STOP What was the change that occurred in the TEMPLATE DNA STRAND? Substitution or Indel Transition or transversion (or NA) Nucleotide changed by If substitution: Original nucleotide and then new nucleotide If insertion: Nucleotide inserted and then write "inserted" in the second space If deletion: Nucleotide deleted, and then write "deleted"
1A. True or False? A change in the amino acid sequence in a gene will always...

1A. True or False? A change in the amino acid sequence in a gene will always result in a change in the nucleotide sequence of a protein. 1B. Briefly explain/defend your answer.

In the process of __________, the nucleotide sequence in a mRNA molecule specifies the amino acid...

In the process of __________, the nucleotide sequence in a mRNA molecule specifies the amino acid sequence of a protein. a) Transcription b) Translation c) Coding d) None of the above
Nonsynonymous mutations in genes are nucleotide changes that alter the amino acid sequence of the translated...

Nonsynonymous mutations in genes are nucleotide changes that alter the amino acid sequence of the translated protein, potentially leading to a change in protein function. Using your knowledge of the genetic code, which ONE of the following amino acid replacements can be caused by a single-base change? Select one: a. Val → Lys b. Asp → Thr c. Pro → Val d. Gly → Leu e. Cys → Phe
Which RNA molecule carries the nucleotide sequence responsible for the amino acid sequence in proteins? messenger...

Which RNA molecule carries the nucleotide sequence responsible for the amino acid sequence in proteins? messenger RNA transfer RNA ribosomal RNA translator RNA

What amino acid sequence does the following mRNA nucleotide sequence specify? 5′−AUGAACCUAUGC−3′ Express the sequence of...

What amino acid sequence does the following mRNA nucleotide sequence specify? 5′−AUGAACCUAUGC−3′ Express the sequence of amino acids using the three-letter abbreviations, separated by hyphens (e.g., Met-Ser-Thr-Lys-Gly).
In the following DNA sequence a nucleotide base change occurred at nucleotide 19, changing the C...

In the following DNA sequence a nucleotide base change occurred at nucleotide 19, changing the C nucleotide in the template strand to an A, the coding strand was unaffected. Original Template DNA: 3’ AGCCTTTGCTACGCCGACCACATTGCG 5’ a) Write out your new template DNA strand with this point mutation. b) What kind of base substitution occurred? Explain your answer. c) How does it affect the amino acid sequence derived from this DNA sequence? (Be specific, translate the mRNA)
Examine the following nucleotide sequence from the sense strand of DNA. What is the amino acid...

Examine the following nucleotide sequence from the sense strand of DNA. What is the amino acid sequence of the encoded protein? (Show work) ATG - CCT - TAC - GCC - CCT - GGA - GAC - GAA - AAG - AAG - GGT

1. The following nucleotide sequence is found on a strand of mRNA. Give the altered amino...

1. The following nucleotide sequence is found on a strand of mRNA. Give the altered amino acid sequence of the protein that will be found in each of the following mutations. Please also list an anticipated phenotypical change(s) (nonsense, missense, frameshift, addition/subtraction of amino acid etc.) (1 pts each) Second position Nucleotide #: 1 4 7 10 13 U UUU 16 19 22 UCU UAU UGU UUC UAC UAA UUA UUD RNA: 5-AUG ACC GGC AAU CAA CUA UAU UGA-3'...