1A. True or False? A change in the amino acid sequence in a gene will always...
QU. 5. You have identified the complete amino acid sequence on protein sequencing techniques. "Y" is composed of 44 amino acids with the po below. No information is available about its genetic sequence. Your task sequence for protein "Y". Assume that the gene sequence is unique in the human 5 BRIEFLY EXPLAIN methodically and accurately how you will decipher the gene seg "Y". (3 POINTS). no acid sequence of a human protein called "Y" using 1.44 amino acids with the...
What is the gene sequence(FASTA format) and amino acid sequence for the CFTR gene/protein? If you can provide a link to where you find this, that would be amazing!
Question 12 Which mutation has a change in the DNA sequence but no change in the amino acid sequence? Question 4 Match the nucleotide pictures to their names.
True or false: in translation, complimentary nucleotides are matched and converted into amino acid sequence. False; in translation codon nucleotides are bound directly to amino acids False; in translation nucleotides are matched by complementarity but amino acid sequence is unrelated True; codons matching anti-codons is the only process where complimentary nucleotides associate True; nucleotides on mRNA and on tRNA are complimentary (the operon and anti-codon) and the tRNA carries a single amino acid
Will a single base pair change in a gene (DNA/RNA) always result in a change to the protein sequence? How will a frameshift mutation at the DNA/RNA level affect the protein sequence?
Question 8 4 pts After a single base pair change, the following amino acid sequence was altered. Original amino acid sequence: Met-Glu-Tyr-Leu-Phe Altered amino acid sequence: Met-Glu-STOP What was the change that occurred in the TEMPLATE DNA STRAND? Substitution or Indel Transition or transversion (or NA) Nucleotide changed by If substitution: Original nucleotide and then new nucleotide If insertion: Nucleotide inserted and then write "inserted" in the second space If deletion: Nucleotide deleted, and then write "deleted"
1. Researchers discovered that a single amino acid change of cysteine to tryptophan in a transmembrane protein causes retinal degeneration. 1a. Using the genetic code, what mutant mRNA likely encodes this substitution and what is the WT mRNA sequence? (Indicate polarity) 1b. Is the substitution caused by a transition or transversion mutation?
Nonsynonymous mutations in genes are nucleotide changes that alter the amino acid sequence of the translated protein, potentially leading to a change in protein function. Using your knowledge of the genetic code, which ONE of the following amino acid replacements can be caused by a single-base change? Select one: a. Val → Lys b. Asp → Thr c. Pro → Val d. Gly → Leu e. Cys → Phe
Any change in the normal nucleotide sequence that codes for an amino acid is called a ___________________________________. a.transcription b.protein synthesis c.mutation d.replication e.translation
4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is underlined. The +1 nucleotide is shown in boldface and red. a. Write the sequence of the mRNA that would be produced by this gene. You may assume that the gene ends at the end of the sequence shown, so you do not need to look for transcription termination signals. You may also assume that it has no introns 5' GCGGTATAACAGGACAGGCTGCATGAGAAGATTCCATCTTCCAGATCACTGTCCTTCTAGCCATGGAAAATGA CGAATTGTGACTGCCCCTGC3' mRNA (make sure...