How do you set up a restriction digest? What are the controls? What is the purpose of controls? What are the components and what is the purpose of each component?
Solution -
Restriction enzymes or endonucleases are enzymes that recognize
short, specific DNA sequences. They cleave
double-stranded DNA at specific sites within or adjacent to their
recognition sequences.
Each restriction enzyme has specific requirements for optimal
activity.
Experimental controls are necessary to identify, understand and
explain problems or inconsistencies in results. The
following controls are commonly used in parallel with RE
digests:
Restriction digestion is usually used to prepare a DNA fragment for subsequence molecular cloning, as the procedure allows fragments of DNA to be pieced together like building blocks via ligation.
The components of a typical restriction digestion reaction include the DNA template, the restriction enzyme of choice, a buffer and sometimes BSA protein. The reaction is incubated at a specific temperature required for optimal activity of the restriction enzyme and terminated by heat.
How do you set up a restriction digest? What are the controls? What is the purpose...
1- How do you set up a restriction digest? What are the controls? What is the purpose of controls? What are the components and what is the purpose of each component? 2- Why is mixing a critical step? 3- What kinds of information can you get by examining your phage by electron microscopy? 4- What is centrifugation? How does it work? Why is it useful? What properties of molecules can be exploited to achieve separation of a mixture of molecules...
If you were setting up a 20μl restriction digest, how much of the 5X buffer would you use? a. 2.0 μl b. 4.0 μl c. 16 μl d. 5 times the volume of restriction endonuclease used.
Suppose you are going to do a restriction digest with a plasmid, using the restriction enzyme Eco R1. A map of the plasmid is shown here. The entire plasmid is 6000 bp, and there are Eco R1 restriction sites at 1500 bp, 2000 bp, and 4000 bp. You’re going to run the entire volume of the digest on a gel, and you want to cut just enough DNA to have 50 ng in the smallest band on your gel. Starting...
What restriction digest pattern do you expect for a homozygous WT individual? A homozygous mutant individual? A heterozygous individual? Update: in regard to PTC study with TAS2R38 gene in position 262
You are using three restriction enzymes to digest a double-stranded DNA in which the sequence of the upper strand is 5'-TTGTCGATGCGAATTCGGTGATGGATCCTAGGTCGTGTAGCATGCATGCCGGATCCTAGCTGAGC'-3. The recognition sites of the enzymes are G'AATTC (EcoRI), G'GATCC (BamHI), and GCATG'C (SphI). The cleavage sites are indicated with '. Determine how long the DNA fragments will be after digesting the DNA with each of these enzymes individually. Additionally, determine the length of the fragments if you digest with both enzymes BamHI and SphI. In a drawing, show...
You want to digest the phage genomic DNA you just isolated with a restriction enzyme called HaeIII. You find the enzyme and a 10X stock of HaeIII enzyme buffer in the freezer. How much buffer will you add if the total volume of your reaction is 50 microliters?
question number 7 purifying plasmid from your cells, you will set up a teaction to cut the plasmid DNA with the restriction enzyme Bgl Il. See the map below for the positions of the Bgl Il restriction enzyme sites on the plasmid. How many DNA fragments would you expect if your restriction enzyme digest was complete and your plasmid contains insert? Question 7 Not yet graded/ 1 pts After you electrophoresed the plasmid digest in Question 6, your gel showed...
Unanswered Question 6 0/1 pts A restriction digest is performed on a plasmid. The table below shows the sizes of the resulting DNA fragments. 3 enzyme(s) present in the DNA size fragments digest resulting Pstl 10,000 base pairs (bp) Sspl 7,000 bp, 3,000 bp double digest, Estland 4,000 bp, 3,000 bp Sspl Explain the double digest results, what happened to create pieces of these sizes? Your Answer: 4/4 pts Question 7 List the 5 components needed to perform a PCR...
You digest a 10Kb Linear ECoRI dna fragment with TWO restriction enzymes and obtain the following data Hind iii..... 3kb, 7kb BamHi ... 2 kb and 8kb HInd iii + bamHI ..... 1kb, 2kb, 7kb Draw a restriction map of this DNA fragment, labeling the sites for EcoRI, bahHI, and HIndiii
Progress 0% DO Multiple Choice Question What is the purpose of internal controls? O Internal controls are used by managers as a way to reduce outstanding customer balances O Managers utilize internal controls as a basis of employee performance reviews O Companies use strong internal controls to guarantee that loss is eliminated O Companies create internal controls to protect assets and ensure reliable accounting Confidence Level Rate your conticence to submit your answer Resources