If two polypeptides share a great deal of amino acid sequence identity and similarity, what else...
- If two polypeptides share a great deal of amino acid sequence identity and similarity, what else is likely to be true?
Homework Answers
If two polypeptides have great deal of amino acid sequence identity and similarity they would have different confirmatioms.For example Bovine and pancreatic phospolipase A2 has almost same amino acid sequence except at 12 substitution loop Phe is replaced by valine has quite different confirmation but the rest of molecules has same foldings.From this observation it is concluded that the prediction of 3 dimensional structure based on the sequence similarity gives errorness results.
Add Answer to:
If two polypeptides share a great deal of amino acid sequence
identity and similarity, what else...
which of the following is not a way in which amino acid structure in sequence might...
which of the following is not a way in which amino acid structure in sequence might affect the properties of a protein a) Amino acid side chains form peptide bonds with each other causing the molecule to twist into a secondary structure b) Amino side chains interact with each other causing polypeptides to bend into a tertiary structure c) Hydrogen bonding between every fourth amino acid results in the formation of a coil called an a helix d) Hydrogen bonding...
Take the amino acid sequence DELIFFLIF and calculate the most likely state sequence using the Viterbi...
Take the amino acid sequence DELIFFLIF and calculate the most likely state sequence using the Viterbi algorithm. Turn in the Viterbi matrix, and the most likely state sequence. Write a program for this decoding process.
The following sequence is part of the DNA TEMPLATE for a 4 amino acid peptide that...
The following sequence is part of the DNA TEMPLATE for a 4 amino acid peptide that starts with Methionine. 5- TTATTCTTTAAT CAT-3 What would be the consequences of the highlighted A to be mutated to a G? Select one: a. The resulting peptide will likely be larger than the non-mutant peptide b. the primary sequence of the peptide will be different on one amino acid O C. The peptide sequence would be the same d. all the amino acids after...
The following sequence is part of the DNA TEMPLATE for a 4 amino acid peptide that...
The following sequence is part of the DNA TEMPLATE for a 4 amino acid peptide that starts with Methionine. 5'- TTATTCTTTAAT CAT-3' What would be the consequences of the highlighted A to be mutated to a G? Select one: a. the primary sequence of the peptide will be different on one amino acid b. all the amino acids after the mutation will be different than the non-mutant peptide c. The peptide sequence would be the same d. The resulting peptide...
True or false: in translation, complimentary nucleotides are matched and converted into amino acid sequence. False;...
True or false: in translation, complimentary nucleotides are matched and converted into amino acid sequence. False; in translation codon nucleotides are bound directly to amino acids False; in translation nucleotides are matched by complementarity but amino acid sequence is unrelated True; codons matching anti-codons is the only process where complimentary nucleotides associate True; nucleotides on mRNA and on tRNA are complimentary (the operon and anti-codon) and the tRNA carries a single amino acid
pulli 6) What is the sequence of amino acid specified by K-R-G-P, draw the amino acid...
pulli 6) What is the sequence of amino acid specified by K-R-G-P, draw the amino acid showing the peptide bonds, asymmetric carbon centers and planar regions.
The mRNA reads UGUGAUGACGAACGAGGGACUGA What does the tRNA sequence read? What will be the amino acid...
The mRNA reads UGUGAUGACGAACGAGGGACUGA What does the tRNA sequence read? What will be the amino acid sequence?
8. Polypeptides have such great biological importance because a) they are long, complex strings, formed from...
8. Polypeptides have such great biological importance because a) they are long, complex strings, formed from monomers. b) Their "R groups enable them to form complex biomolecules with specific shapes. c) Their 'R' groups have 20 different shapes and charge patterns. d) The 'R' groups can have positive or negative charges or be neutral. e) All are true 9. RNA is a polymer consisting of monomers called a) amino acids b) monosaccharides c) fats, d) nucleotides e) nucleic acids 10....
What amino acid sequence does the following mRNA nucleotide sequence specify? 5′−AUGAACCUAUGC−3′ Express the sequence of...
What amino acid sequence does the following mRNA nucleotide sequence specify? 5′−AUGAACCUAUGC−3′ Express the sequence of amino acids using the three-letter abbreviations, separated by hyphens (e.g., Met-Ser-Thr-Lys-Gly).
1A. True or False? A change in the amino acid sequence in a gene will always...
1A. True or False? A change in the amino acid sequence in a gene will always result in a change in the nucleotide sequence of a protein. 1B. Briefly explain/defend your answer.
The following sequence is part of the DNA TEMPLATE for a 4 amino acid peptide that starts with Methionine. 5- TTATTCTTTAAT CAT-3 What would be the consequences of the highlighted A to be mutated to a G? Select one: a. The resulting peptide will likely be larger than the non-mutant peptide b. the primary sequence of the peptide will be different on one amino acid O C. The peptide sequence would be the same d. all the amino acids after...
The following sequence is part of the DNA TEMPLATE for a 4 amino acid peptide that starts with Methionine. 5'- TTATTCTTTAAT CAT-3' What would be the consequences of the highlighted A to be mutated to a G? Select one: a. the primary sequence of the peptide will be different on one amino acid b. all the amino acids after the mutation will be different than the non-mutant peptide c. The peptide sequence would be the same d. The resulting peptide...
pulli 6) What is the sequence of amino acid specified by K-R-G-P, draw the amino acid showing the peptide bonds, asymmetric carbon centers and planar regions.
The mRNA reads UGUGAUGACGAACGAGGGACUGA What does the tRNA sequence read? What will be the amino acid sequence?
8. Polypeptides have such great biological importance because a) they are long, complex strings, formed from monomers. b) Their "R groups enable them to form complex biomolecules with specific shapes. c) Their 'R' groups have 20 different shapes and charge patterns. d) The 'R' groups can have positive or negative charges or be neutral. e) All are true 9. RNA is a polymer consisting of monomers called a) amino acids b) monosaccharides c) fats, d) nucleotides e) nucleic acids 10....
Most questions answered within 3 hours.
-
Company AAA produces only one product which other manufacturers
purchase as a component for their final...
asked 1 hour ago -
An
item can be appended to an array-based list, provided the lenght is
less than the...
asked 1 hour ago -
Two particles each have a rest mass energy of 30 MeV and are
traveling with a...
asked 3 hours ago -
why
is vectorization a faster alternative to loops?
asked 4 hours ago -
General Matter’s outstanding bond issue has a coupon rate of
11.8%, and it sells at a...
asked 4 hours ago -
Write a one page essay on how important is it to know your basic
accounting knowledge...
asked 4 hours ago -
You are a Senior Civil Engineer posted at the Contracts and
Procurement Division of the Ministry...
asked 4 hours ago -
When using the percentage of completion method, the
company
- recognizes revenues and gross profit each...
asked 4 hours ago -
Is a level production strategy suitable for a pure service
industry, such as professional accounting and...
asked 4 hours ago -
Baker Industries’ net income is $23000, its interest expense is
$4000, and its tax rate is...
asked 5 hours ago -
a) A proton moves at 500 m/s in a 2 T magnetic field. What is
the...
asked 5 hours ago -
Anderson Systems is considering a project that has the following
cash flow and WACC data. What...
asked 5 hours ago