Question

please help, thank you!

The DNA sequence below represents an edited version of the PISTILLATA gene from the model plant Arabidopsis thaliana. The sequence comes from the nontemplate (coding) strand. Use the sequence to answer all questions on this assignment. 9 5'-TTTCTCTCTCTATCTCATCAATGTTACTTTAAAACCAATTTACCTTAATAGGTAAGCTCCTCTTCTTG TTCTTCATATAAATCCACATATCCTCTCCTCCATATCTTAACAATTTCATAGCAAACCCTAAAATTGAGA AAGAGATAGAGAGAGAAAGATGGGTAGAGGAAAGATCGAGATAAAGAGGATAGAGAACGCAAACAA CAGAGTGGTGACGGTATCCTTGCTCTCTTTTTAATCTAAAGTTTCTTTGTCTCAAAAATATTCCATGGC CAAAATCATGTAATAAGTTTTCAATTTCTTTACCAAAAACATGTCAAAAGACCCTTGAATCTTTAACCCT AGATGCAGATAACAACAGGAGATGGGATGATGAGAGATCATGACTCGATTGATCATCGAGATTTTAT AATCTCATCCTGATCAACTCCTATCTATAATATCGTGGTCTTTAGTTTGTCTTTATCAATCTGTGTGTCT TAATCTCAATAAAATATACTCATTAAAATCAAAATCCATAAATACGGACATAAACACGACAGACTTACG -3 0 . What kind of gene features would you expect Arabidopsis thaliana to have, bacterial or eukaryotic? 2. The gene contains a sequence that is recognized by the AP1 transcription factor, located about 50 nucleotides upstream of the transcription start site. The consensus sequence for the AP1 transcription factor is 5'-TTACC(A/T(A/T A/T A/T(ATATGG(A/T/C)AA-3'. [Nucleotides in parentheses mean that genes typically have one of the listed nucleotides. For example, an acceptable API recognition sequence would be 5'-TTACCATTAATGGCAA-3] Format the AP1 recognition sequence in the PISTILLATA gene sequence to be underlined. 5 3. The gene also contains a commonly occurring 'TATA box', located about 25 nucleotides upstream of the transcription start site. The consensus sequence for a TATA box is 5'-TATA(T/A)A(T/A)3' Format the TATA box in the PISTILLATA gene sequence to be underlined. [There may be multiple sequences that match the TATA box consensus sequence. The one that is involved in transcription initiation should be located near the AP1 consensus sequence.]

Answer 1

1.eukaryotic since eukaryotes are organisms whose cells have a nucleus enclosed within membranes, unlike prokaryotes (Bacteria and Archaea), which have no membrane-bound organelles.

2. Find in the sequence TTACC and then start writing the next nucleotides.

I found it in the first line:

TTACC-TTAATAGGT

3.Same.. if you continue reading the letters, in the second line, close the AP1 consensus, you can find a TATA box:

TTCTTCATATAAATCCACATA...

So it says that the consensus sequence is TATA (T/A)A(T/A)... in this case is TATA- AAT