(Molecular Biology) Draw a diagram of a gene region in DNA from the promoter to end of...
(Molecular Biology) Draw a diagram of a gene region in DNA from the promoter to end of the 3' UTR. Label the TATA box and BRE, the transcription start site, translation start site, 5' UTR, any at least two exons and 1 intron, 3' UTR, and start and stop codons.
Homework Answers
Add Answer to:
(Molecular Biology) Draw a diagram of a gene region
in DNA from the promoter to end of...
Draw a Eukaryotic Gene Schematic Draw features of importance at the DNA level Transcription start site...
Draw a Eukaryotic Gene Schematic Draw features of importance at the DNA level Transcription start site +1 Promoter - as much detail as you can Gene start ATG and stop codons Transcription Regulatory Sequences such as activators/repressors and enhancers/insulators Draw features of importance at the pre-mRNA level Designate Introns and Exons Designate important Sequences to direct and regulate splicing three important sequences for the chemistry of splicing splicing regulatory sequences (ISS, ISE, ESE, ESS) Modifications at level of pre-mRNA UTRs,...
6. In the drawings below note and label all important elements (incl.consensus sequences) discussed in lectures...
6. In the drawings below note and label all important elements (incl.consensus sequences) discussed in lectures and tutorial manual and listed below. Prokaryotis operon promoter (-10 and -35 elements), operator, multiple structural renes (for example 3), start site of transcription, start sites of translations, transcription termination sequence Prokaryotic mRNA (polycistronie): transcription start site, multiple ribosome binding sites The Shine-Dalgamo sequence in Ecoli), multiple ORFs (including start and stop codons). transcription termination sequence Eukaryotic genes promoter (TATA box), consensus sequence CAAT,...
The diagram below shows a structure of an eukaryotic gene. Each pattern refers to a different...
The diagram below shows a structure of an eukaryotic gene. Each pattern refers to a different part of a gene. Using the pattern, label the diagram for the location of following: a. enhancer, b- promoter, c- transcription start, d- translation start: e- exon, i- intron, f- coading sequence, t1 -transcription stop, t2 -translation stop Put the corresponding letter on top of the pattern to show the location b. How pre-mRNA transcribed from this gene will look like? You may use...
3. Prokaryotic and eukaryotic gene expression compared. Below is an incomplete table of prokaryotic and eukaryotic...
3. Prokaryotic and eukaryotic gene expression compared. Below is an incomplete table of prokaryotic and eukaryotic gene expression in comparison. Fill in the blank using PPT slides, notes and the textbook. Prokaryotic gene expression Eukaryotic gene expression Overview Steps Transcription and translation Yes Transcription and translation coupled? Gene structure No introns Epigenetic modification (chromosome remodeling) transcription, translation, RNA processing, protein processing Transcription in the nucleus and translation in the cytoplasm Interrupted gene with exons and introns RNAPI, II, III Which...
1. Describe the three stages in transcription in prokaryotes and note the functions of the enzymes...
1. Describe the three stages in transcription in prokaryotes and note the functions of the enzymes that are involved for each. 2. Describe three ways in which transcription in in eukaryotes is different from that of prokaryotes. 3. At what stage of transcription do these alterations take place in? Initiation, Elongation or Termination? 4. Draw a prokaryotic gene with the following features: a. A promoter region with -35 and -10 consensus sequences. b. The start point of transcription with first...
Please include: RNA pol II, TBP, TFIIB, TFIID, TCF4. Mediator, BRE, TATA, Inr, DPE, E box...
Please include:
RNA pol II, TBP, TFIIB, TFIID, TCF4. Mediator, BRE, TATA, Inr, DPE,
E box
Question 5: (5 marks) Mediator is a protein complex that is able to act as a bridge between transcriptional activators and the TFIID-dependent RNA Pol II machinery. Draw what you would expect the promoter region to look like with Mediator acting at the promoter of a gene with an E-box 3000bp upstream of the transcriptional start site, which requires TCF4 for activation of transcription....
Below is a diagram of a transcription unit and the mRNA made from the transcription unit:...
Below is a diagram of a transcription unit and the mRNA made from the transcription unit: A H TTGACA DNA TATAAT -35 B -10 С D - Start codon Stop codon mRNA 5' 3' E F G Is this a prokaryotic or eukaryotic transcription unit? prokaryotic What is the name of the cofactor required for RNA polymerase to bind to the promoter? Which letters on the above diagram correspond to the following structures? Promoter Pribnow box Non-template strand Transcriptional start...
3of 3 9. The figure below represents the primary transcript of a gene that contains four exons (A, B, C, D) and two introns. The dark block in exon B indicates the position of an additional stop...
3of 3 9. The figure below represents the primary transcript of a gene that contains four exons (A, B, C, D) and two introns. The dark block in exon B indicates the position of an additional stop codon; the normal start and stop codons for translation are present in exons A and D respectively. The two arrows indicate alternative 3' splice sites for the first intron Pre-mRNA 5'I 3' intron intron Give a schematic representation of the mature mRNAs that...
Below is a diagram of a transcription unit and the mRNA made from the transcription unit:...
Below is a diagram of a transcription unit and the mRNA made from the transcription unit: А H DNA TTGACA TATAAT -35 B -10 C D Start codon Stop codon mRNA 5 E F G Is this a prokaryotic or eukaryotic transcription unit? What is the name of the cofactor required for RNA polymerase to bind to the promoter? Which letters on the above diagram correspond to the following structures? Promoters Pribnow box Non-template strand Transcriptional start site- Open Reading...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...
Draw a Eukaryotic Gene Schematic Draw features of importance at the DNA level Transcription start site +1 Promoter - as much detail as you can Gene start ATG and stop codons Transcription Regulatory Sequences such as activators/repressors and enhancers/insulators Draw features of importance at the pre-mRNA level Designate Introns and Exons Designate important Sequences to direct and regulate splicing three important sequences for the chemistry of splicing splicing regulatory sequences (ISS, ISE, ESE, ESS) Modifications at level of pre-mRNA UTRs,...
6. In the drawings below note and label all important elements (incl.consensus sequences) discussed in lectures and tutorial manual and listed below. Prokaryotis operon promoter (-10 and -35 elements), operator, multiple structural renes (for example 3), start site of transcription, start sites of translations, transcription termination sequence Prokaryotic mRNA (polycistronie): transcription start site, multiple ribosome binding sites The Shine-Dalgamo sequence in Ecoli), multiple ORFs (including start and stop codons). transcription termination sequence Eukaryotic genes promoter (TATA box), consensus sequence CAAT,...
The diagram below shows a structure of an eukaryotic gene. Each pattern refers to a different part of a gene. Using the pattern, label the diagram for the location of following: a. enhancer, b- promoter, c- transcription start, d- translation start: e- exon, i- intron, f- coading sequence, t1 -transcription stop, t2 -translation stop Put the corresponding letter on top of the pattern to show the location b. How pre-mRNA transcribed from this gene will look like? You may use...
3. Prokaryotic and eukaryotic gene expression compared. Below is an incomplete table of prokaryotic and eukaryotic gene expression in comparison. Fill in the blank using PPT slides, notes and the textbook. Prokaryotic gene expression Eukaryotic gene expression Overview Steps Transcription and translation Yes Transcription and translation coupled? Gene structure No introns Epigenetic modification (chromosome remodeling) transcription, translation, RNA processing, protein processing Transcription in the nucleus and translation in the cytoplasm Interrupted gene with exons and introns RNAPI, II, III Which...
1. Describe the three stages in transcription in prokaryotes and note the functions of the enzymes that are involved for each. 2. Describe three ways in which transcription in in eukaryotes is different from that of prokaryotes. 3. At what stage of transcription do these alterations take place in? Initiation, Elongation or Termination? 4. Draw a prokaryotic gene with the following features: a. A promoter region with -35 and -10 consensus sequences. b. The start point of transcription with first...
Please include:
RNA pol II, TBP, TFIIB, TFIID, TCF4. Mediator, BRE, TATA, Inr, DPE,
E box
Question 5: (5 marks) Mediator is a protein complex that is able to act as a bridge between transcriptional activators and the TFIID-dependent RNA Pol II machinery. Draw what you would expect the promoter region to look like with Mediator acting at the promoter of a gene with an E-box 3000bp upstream of the transcriptional start site, which requires TCF4 for activation of transcription....
Below is a diagram of a transcription unit and the mRNA made from the transcription unit: A H TTGACA DNA TATAAT -35 B -10 С D - Start codon Stop codon mRNA 5' 3' E F G Is this a prokaryotic or eukaryotic transcription unit? prokaryotic What is the name of the cofactor required for RNA polymerase to bind to the promoter? Which letters on the above diagram correspond to the following structures? Promoter Pribnow box Non-template strand Transcriptional start...
3of 3 9. The figure below represents the primary transcript of a gene that contains four exons (A, B, C, D) and two introns. The dark block in exon B indicates the position of an additional stop codon; the normal start and stop codons for translation are present in exons A and D respectively. The two arrows indicate alternative 3' splice sites for the first intron Pre-mRNA 5'I 3' intron intron Give a schematic representation of the mature mRNAs that...
Below is a diagram of a transcription unit and the mRNA made from the transcription unit: А H DNA TTGACA TATAAT -35 B -10 C D Start codon Stop codon mRNA 5 E F G Is this a prokaryotic or eukaryotic transcription unit? What is the name of the cofactor required for RNA polymerase to bind to the promoter? Which letters on the above diagram correspond to the following structures? Promoters Pribnow box Non-template strand Transcriptional start site- Open Reading...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...
Most questions answered within 3 hours.
-
Construction Cost Analysis and Estimating:
A project requires 17,000 allowed hours. Location of the work is...
asked 5 minutes ago -
1: In 802.11b, Access Point (AP) delivers a nonce to the Station
(STA). This nonce is...
asked 5 minutes ago -
calculate change in entropy and change in enthalpy for freezing
1 mol of water at -10C...
asked 12 minutes ago -
In your opinion, did anyone "win" the Cold War? If no, why? If
yes, who won...
asked 16 minutes ago -
a) Determine the saturation dissolved oxygen concentration at
sea-level at 1 atm and 20° C in...
asked 13 minutes ago -
Please complete the implementation of the four functions IN
C.
//************************************************************************************/
//
// countNumberofOnes
//
//...
asked 16 minutes ago -
Shown below are the budgeted sales for ABC Company for
the next six months:
Sales...
asked 20 minutes ago -
A balance sheet shows exactly where a business stands at any
given point in time. It...
asked 21 minutes ago -
For the reaction between ethylene and chlorine, the equilibrium
constant is 2.00x10^6. If the initial concentrations...
asked 29 minutes ago -
What is the energy released in this β+ nuclear reaction
23/12Mg→23/11Na+0/1e (The atomic mass of 23Mg...
asked 43 minutes ago -
Choose one:
Periodic Inventory Accounting is less expensive to maintain
than Perpetual Inventory Accounting
Periodic Inventory...
asked 41 minutes ago -
4. Describe the role played by glutamine in the transport of
nitrogen.
asked 39 minutes ago