Question

1. Use Figure 10 as a reference to construct a strand of Pop-it® beads with the same color pattern. This is your DNA strand.Table 1: Enzyme Analysis Cuts Between... Number of Fragments Fragment Sizes in order) Enzyme 1 Enzyme 2 Enzyme 3 OOor OO Enzy

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Answer: Enzyme 1: 3 fragments. Sizes: 23 nucleotides long, 9 nucleotides long and 4 nucleotides long.

Enzyme 2: 3 fragments. Sizes: 17 nucleotides long, 11 nucleotides long, 7 nucleotides long.

Enzyme 3: 6 fragments. Sizes: 5 nucleotides long, 3 nucleotides long, 5 nucleotides long, 10 nucleotides long, 7 nucleotides long, 5 nucleotides long.

Enzyme 4: 4 fragments. Sizes: 2 nucleotides long, 8 nucleotides long, 24 nucleotides long, 1 nucleotide long.

Enzyme 5: 9 fragments. 5, 10, 5, 2, 5, 6, 5, 2and 5 nucleotides long.

The enzyme cuts in between the designated places and the number of nucleotides are to be counted in between for the estimation of the sizes.

Hope the answer is satisfying. Kindly leave a rating.

Add a comment
Know the answer?
Add Answer to:
1. Use Figure 10 as a reference to construct a strand of Pop-it® beads with the...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • can someone explain throughly on how to find a-c??? thanks!!! The following question will provide practice in interpreting and analyzing gel results. 5. You obtained the DNA electrophoresis gel be...

    can someone explain throughly on how to find a-c??? thanks!!! The following question will provide practice in interpreting and analyzing gel results. 5. You obtained the DNA electrophoresis gel below. Three samples of lambda phage DNA were digested with 3 different restriction enzymes and the digested DNA was applied to the gel in lane 4 and the bands were visualized. The Hind Ill digest was used as a molecular weight standard marker and produced 6 DNA fragments of known size:...

  • Hi I have a problem with number 5, it involves gel analysis results. There are 2 parts, a,b,c. For A Im sure you need to make a graph with distance in (cm) on the vertical axis and log10 bp on the hor...

    Hi I have a problem with number 5, it involves gel analysis results. There are 2 parts, a,b,c. For A Im sure you need to make a graph with distance in (cm) on the vertical axis and log10 bp on the horitzontal. I need help figuring out where to start and what to do. Please help! The following question will provide practice in interpreting and analyzing gel results You obtained the DNA electrophoresis gel below. Three samples of lambda phage...

  • what is the purpose, claim,hypothesis and evidence for restriction endonucleases lab Biomolecular Techniques EXPERIMENT 2: RESTRICTION...

    what is the purpose, claim,hypothesis and evidence for restriction endonucleases lab Biomolecular Techniques EXPERIMENT 2: RESTRICTION ENDONUCLEASES Data Tables Purpose (What question is this experiment designed to answer?): Does the fragment size affect the enzyme? Hypothesis (Based on what you've learned in the pre-lab materials, write and If/Then statement regarding the outcome of this experiment.) Table 1: Enzyme Analysis Cuts Between Number of Fragments Fragment Size (in order) 22,9,4 17,11,7 3 Enzyme 1 Enzyme 2 Enzyme 3 4 5,3,15,12 ОО...

  • 1. If a template strand reads: 3’-TTG CAA TGC AAC-5’ what will the new strand read?...

    1. If a template strand reads: 3’-TTG CAA TGC AAC-5’ what will the new strand read? 2. How are new nucleotide monomers attached to the growing strand? What is the reaction that takes place? How is dATP different from ATP? 3. Why does the lagging strand exist? 4. In the lagging strand, what is the enzyme that replaces the RNA primer with DNA? What enzyme then connects the two fragments together? 5. The replication machinery is very accurate but every...

  • 1. Why do plasmid vectors contain a polylinker? So that the plasmid can be cut into...

    1. Why do plasmid vectors contain a polylinker? So that the plasmid can be cut into many small fragments to be inserted in the region of interest To allow the plasmid to survive on antibiotic media To find a restriction enzyme site that is useful for inserting the fragment of interest Multiple cut sites are required for the DNA fragment to be inserted. 2.What does blue color mean in blue-white screening with pUC18? The DNA fragment was successfully inserted into...

  • Hi can someone help me understand part C and why the drawn in red lines are...

    Hi can someone help me understand part C and why the drawn in red lines are where they are. Basically from the bp given how can I go back to cm so I can drawn them into the picture provided? Do not need help with A or B. The following question will provide practice in interpreting and analyzing gel results You obtained the DNA electrophoresis gel below. Three samples of lambda phage DNA were digested with 3 different restriction enzymes...

  • Use the following depiction of a gel of Hind III fragments to answer the questions: 1...

    Use the following depiction of a gel of Hind III fragments to answer the questions: 1 Kb Ladder Possible Hind III Fragments: 1 Kb Ladder Sizes 10,000 8,000 564 bp 8,888 2.0 kb 2.3 kb 11 4.36 kb 4,000 3,000 2,500 2,000 1,500 6.5 kb 9.4 kb 23 kb 1,000 750 500 250 1. Based on the gel results, list the sizes of the chromosome fragments cloned: 2. Based on the gel results, list the sizes of the chromosome fragments...

  • 1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2....

    1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2. What enzyme facilitates the complementary base pairing used to make the complementary strand in question #1. 3. At what site on the DNA molecule does transcription initiate? At what site on the DNA does transcription terminate? 4. Use the DNA molecule from question #1 and transcribe an mRNA molecule. Show the nucleotide sequence of the mRNA molecule. 5. What enzyme is responsible for transcription?...

  • The figure below shows a restriction map of a segment of a DNA molecule. Eco refers...

    The figure below shows a restriction map of a segment of a DNA molecule. Eco refers to locations where the restriction endonuclease EcoRI cuts the DNA, and Pst refers to locations where the restriction enzyme Pst cuts the DNA. Potential restriction sites are numbered 1-6. Distances between restriction sites are shown on the bottom scale in base pairs (bp). The thick line represents the part of the molecule that has homology with a probe. Eco Pst Eco Pst Eco Pst...

  • Write true or false ______ 1. The DNA sequence of one human being is on average...

    Write true or false ______ 1. The DNA sequence of one human being is on average 99.9% identical to another random human being. ______ 2. As of 2009, all living human beings have had their entire genome sequenced. ______ 3. The nucleotide bases present in a DNA sequence are A, U, G, C. ______ 4. Techniques that enabled scientists to clone genes were developed in the 1970s. ______ 5. A restriction enzyme is useful because it is a generic enzyme...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT