A particular E.coli promoter has the following sequences: TTTTAAATTTCCTCTTGACAGGCCCGGAAATAACCTCCCTATAATGCGCCACCCACTGACACG. Identify the Pribnow box, the -35 element...
A particular E.coli promoter has the following sequences: TTTTAAATTTCCTCTTGACAGGCCCGGAAATAACCTCCCTATAATGCGCCACCCACTGACACG. Identify the Pribnow box, the -35 element and the transcription start site.
Homework Answers
Answer:
-35 sequence is TTGACA & Prinbow box is TATAAT
TTTTAAATTTCCTCTTGACAGGCCCGGAAATAACCTCCCTATAATGCGCCACCCACTGACACG. -35 seuence Prinbow box
Add Answer to:
A particular E.coli promoter has the following sequences:
TTTTAAATTTCCTCTTGACAGGCCCGGAAATAACCTCCCTATAATGCGCCACCCACTGACACG.
Identify the Pribnow box, the -35 element...
How do the -10 and -35 consensus sequences in the bacteria promoter relate to evolution? A...
How do the -10 and -35 consensus sequences in the bacteria promoter relate to evolution? A mutation in the -10 (Pribnow) consensus sequence would have what affect?
The TATA binding protein binds to _______________. the promoter in eukaryotes. the promoter proximal element. the...
The TATA binding protein binds to _______________. the promoter in eukaryotes. the promoter proximal element. the +1 transcription start site the promoter in prokaryotes.
Identify the statements that are features of a promoter. Pick all that Apply. A. In eukaryotes,...
Identify the statements that are features of a promoter. Pick all that Apply. A. In eukaryotes, the promoter recruits the preinitiation complex, which includes the TATA-binding protein. b. In prokaryotes, the promoter is recognized by general transcription factors (GTF), which recruit the RNA polymerase holoenzyme. c. In eukaryotes, the promoter attracts the small and large ribosomal subunits with the help of initiation factors. d. In prokaryotes, the promoter contains a –35 and –10 region upstream of the transcription start site...
Below is a diagram of a transcription unit and the mRNA made from the transcription unit:...
Below is a diagram of a transcription unit and the mRNA made from the transcription unit: A H TTGACA DNA TATAAT -35 B -10 С D - Start codon Stop codon mRNA 5' 3' E F G Is this a prokaryotic or eukaryotic transcription unit? prokaryotic What is the name of the cofactor required for RNA polymerase to bind to the promoter? Which letters on the above diagram correspond to the following structures? Promoter Pribnow box Non-template strand Transcriptional start...
2. Identify the following components of the prokaryotic gene below (include appropriate numbering on the DNA):...
2. Identify the following components of the prokaryotic gene below (include appropriate numbering on the DNA): a. Pribnow Box b. -35 region c. 5’ untranslated region d. Template strand e. Nontemplate strand f. Start site of transcription
22. The following is a promoter that is recognized by the sigma (?) factor of the...
22. The following is a promoter that is recognized by the sigma (?) factor of the E. coliRNA polymerase: 5’-ACGAAAAACAGGTATTGACATCATGAAGTAACATGCAGTATAATACAAATCG The bold Gdenotes the transcription start site (+1). Underline, highlight or type the cis-acting elements that will be recognized by the sigma factor. 23. The following sequence is a portion of a eukaryotic promoter. The transcription start site is indicated as the red/bold “g”. 5’-CGGCTCAATAAAATAACAGGAGTCTATAAAAGCGTGGGGACAGTTCAGGAGGGG TBP binds a cis-acting element within this sequence. What is the coordinate (e.g. +5, -5...
6. In the drawings below note and label all important elements (incl.consensus sequences) discussed in lectures...
6. In the drawings below note and label all important elements (incl.consensus sequences) discussed in lectures and tutorial manual and listed below. Prokaryotis operon promoter (-10 and -35 elements), operator, multiple structural renes (for example 3), start site of transcription, start sites of translations, transcription termination sequence Prokaryotic mRNA (polycistronie): transcription start site, multiple ribosome binding sites The Shine-Dalgamo sequence in Ecoli), multiple ORFs (including start and stop codons). transcription termination sequence Eukaryotic genes promoter (TATA box), consensus sequence CAAT,...
Can someone please help me answer these questions. Thank you! Eukaryotic transcription signals a) This drawing shows the placements of the four main sequences of the eukaryotic core promoter for RNA...
Can someone please help me answer these questions. Thank
you!
Eukaryotic transcription signals
a) This drawing shows the placements of the four main sequences of
the eukaryotic core promoter for RNA polymerase II. Identify each
one and give a brief explanation
b) Which sequences are used in a DPE-driven promoter?
c) Which ones are used in a TATA-driven promoter?
d) Please draw and describe the steps as the transcription factors
work with eukaryotic RNA polymerase II to start transcription of...
4. A promoter for an E. coli gene that is transcribed by a s-70 RNA polymerase...
4. A promoter for an E. coli gene that is transcribed by a s-70 RNA polymerase has the following sequence: 30 -20 10 +1 5'GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA 3'CCGAAATGTGAAATACGAAGGCCGAGCATACAACACACCT The transcription start site +1) is identified. a. Identify the -10 and -35 sequences. How close are they to the consensus-10 and-35 sequences? b. What is the spacing between the -10 and the -35 sequences? How does this compare with the consensus spacing? C. The sequence of bases in a transcribed RNA is identical...
Below is a diagram of a transcription unit and the mRNA made from the transcription unit:...
Below is a diagram of a transcription unit and the mRNA made from the transcription unit: А H DNA TTGACA TATAAT -35 B -10 C D Start codon Stop codon mRNA 5 E F G Is this a prokaryotic or eukaryotic transcription unit? What is the name of the cofactor required for RNA polymerase to bind to the promoter? Which letters on the above diagram correspond to the following structures? Promoters Pribnow box Non-template strand Transcriptional start site- Open Reading...
Below is a diagram of a transcription unit and the mRNA made from the transcription unit: A H TTGACA DNA TATAAT -35 B -10 С D - Start codon Stop codon mRNA 5' 3' E F G Is this a prokaryotic or eukaryotic transcription unit? prokaryotic What is the name of the cofactor required for RNA polymerase to bind to the promoter? Which letters on the above diagram correspond to the following structures? Promoter Pribnow box Non-template strand Transcriptional start...
6. In the drawings below note and label all important elements (incl.consensus sequences) discussed in lectures and tutorial manual and listed below. Prokaryotis operon promoter (-10 and -35 elements), operator, multiple structural renes (for example 3), start site of transcription, start sites of translations, transcription termination sequence Prokaryotic mRNA (polycistronie): transcription start site, multiple ribosome binding sites The Shine-Dalgamo sequence in Ecoli), multiple ORFs (including start and stop codons). transcription termination sequence Eukaryotic genes promoter (TATA box), consensus sequence CAAT,...
Can someone please help me answer these questions. Thank
you!
Eukaryotic transcription signals
a) This drawing shows the placements of the four main sequences of
the eukaryotic core promoter for RNA polymerase II. Identify each
one and give a brief explanation
b) Which sequences are used in a DPE-driven promoter?
c) Which ones are used in a TATA-driven promoter?
d) Please draw and describe the steps as the transcription factors
work with eukaryotic RNA polymerase II to start transcription of...
4. A promoter for an E. coli gene that is transcribed by a s-70 RNA polymerase has the following sequence: 30 -20 10 +1 5'GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA 3'CCGAAATGTGAAATACGAAGGCCGAGCATACAACACACCT The transcription start site +1) is identified. a. Identify the -10 and -35 sequences. How close are they to the consensus-10 and-35 sequences? b. What is the spacing between the -10 and the -35 sequences? How does this compare with the consensus spacing? C. The sequence of bases in a transcribed RNA is identical...
Below is a diagram of a transcription unit and the mRNA made from the transcription unit: А H DNA TTGACA TATAAT -35 B -10 C D Start codon Stop codon mRNA 5 E F G Is this a prokaryotic or eukaryotic transcription unit? What is the name of the cofactor required for RNA polymerase to bind to the promoter? Which letters on the above diagram correspond to the following structures? Promoters Pribnow box Non-template strand Transcriptional start site- Open Reading...
Most questions answered within 3 hours.
-
Explain the role of n, the sample size, in determining the size
of a generated confidence...
asked 28 seconds ago -
What is the standard error of M (denoted as
σM ) ?
Options:
The mean of...
asked 11 minutes ago -
Kelsey Drums, Inc., is a well-established supplier of fine
percussion instruments to orchestras all over the...
asked 14 minutes ago -
In a criminal case, the state must not prove its case beyond a
reasonable doubt. T/F
asked 19 minutes ago -
5.6 dm^3 of gaseous HCl (as measured in normal conditions) is
dissolved in 100 cm^3 of...
asked 28 minutes ago -
The hammer throw is a track-and-field event in which a 7.2-kg
ball (the ''hammer''), starting from...
asked 45 minutes ago -
Evaluate a specific listening situation using the Sapir-Whorf
and Bernstein hypothesis. What was thecontext? What was...
asked 52 minutes ago -
Recall that if X is a Student’s t random variable with n df,
then by definition...
asked 1 hour ago -
A charge of -2.95 µC is fixed in place. From a horizontal
distance of 0.0470 m,...
asked 1 hour ago -
Consider the following information:
Your company makes widgets. You are trying to figure out what
volume...
asked 1 hour ago -
Math 333 Plz help ASAP
The yield of a chemical process is being studied. From previous...
asked 1 hour ago -
Cobb-Douglas Preferences: Cobb-Douglas preferences on the
consump-
tion set R2+ can be represented by a utility...
asked 1 hour ago