If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give...
If the sequence of an mRNA molecule is:
5' AUG GGA UUU CGA 3'
(a) Give the sequence of the template strand of DNA. (Please indicate where the 5' and 3' ends are located) (1.5 marks)
(b) Give the sequence of the non-template strand of DNA. (Please indicate where the 5' and 3' ends are located) (1.5 marks)
(c) Give the amino acid sequence. (1.5 marks)
Homework Answers
a) Template strand DNA 3'TAC CCT AAA GCT 5'
b) Non-template strand DNA 5' ATG GGA TTT CGA 3'
c) AUG codes for methionine, GGA codes for glycine, UUU codes for phenylalanine and CGA codes for arginine. Hence the Amino acid sequence is MET-GLY-PHE-ARG
Add Answer to:
If the sequence of an mRNA molecule is:
5' AUG GGA UUU CGA 3'
(a) Give...
If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give...
If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give the sequence of the template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (b) Give the sequence of the non-template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (c) Give the amino acid sequence. (1.5 marks) You will require the following genetic code to answer this question. Second letter с...
If the sequence of an mRNA molecule is: 5' AUG CGA GUU CCG 3' a) Give...
If the sequence of an mRNA molecule is: 5' AUG CGA GUU CCG 3' a) Give the sequence of the template strand of DNA. (Please indicate where the 5' and 3' ends are located) b) Give the sequence of the non-template strand of DNA. (Please indicate where the 5' and 3' ends are located) c) Give the amino acid sequence.
can i get help with this question please Reference Sequence Wild-Type DNA Template Sequence: mRNA Sequence:...
can i get help with this question please
Reference Sequence Wild-Type DNA Template Sequence: mRNA Sequence: Amino Acid Sequence: TAC ACC TTG GCG ACG ACT AUG UGG AAC CGC UGC UGA Met-Top-Asn--Ars--Y-STOP NS. Mutated DNA Template Sequence #5: TAC ACC TTG GGA CGA CT Compare the mutated DNA#5 with the wild-type DNA sequence. Do you observe a substitution, deletion, or insertion mutation? The mRNA sequence derived from mutated DNA #5 is AUG UGG AAC CCU GCU GA Use Table 10.3...
Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5....
Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5' and 3' ends) for each mutated DNA sequence, then transcribe (indicating 5' and 3' ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid...
3. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’ -...
3. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’ - T A C T G A C T G A C G A T C - 5’. Each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. a. Construct the complementary DNA sequences (indicating 5’ and 3’ ends) for each mutated DNA sequence. b. Transcribe (indicating 5’ and 3’ ends) the...
B) If this mRNA is translated beginning with the first AUG codon in its sequence, what is...
B) If this mRNA is translated beginning with the
first AUG codon in its sequence, what is the N-terminal
amino acid sequence of the protein that it encodes?
can you help me solve A and B
The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... a What is the nucleotide sequence of the DNA template strand from which it was transcribed? The Standard Genetic Code AAA Lysine CAA Glutamine GAA Glutamate UAA stop AAC Asparagine CAC | Histidine GAC Aspartate UAC...
1) The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... What is the nucleotide sequence of...
1) The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... What is the nucleotide sequence of the DNA template strand from which it was transcribed? 2) If this mRNA is translated beginning with the first AUG codon in its sequence, what is the N-terminal amino acid sequence of the protein that it encodes?
15. Determine the amino acids following mRNA molecules. ne the amino acid sequence a ribosome would...
15. Determine the amino acids following mRNA molecules. ne the amino acid sequence a ribosome would translate from the *GCACCAUGCAAAGCGGGGAUUAGACCUUU-3 Caution: from which end of the RNA strand does the ribosome begin translating? 3-AGAGUCCAUGCAAAGCGGGGAUUGUACCUUU - 5' 16. Determine the amino acid sequence a ribosome would translate from the following non template DNA strand. (Hint: you must first convert the non template DNA strand to a template DNA strand and then to mRNAJ 3'-ACCTTGATCCTTGACGTATGTAGTATGTATC-5'
S'AUGAUUUUGUACCCAGCCAAAGAAGGGCGAUGA 3' mRNA Codon AUG - start codon AUU Corresponding Amino Acid MET ILE LEU UUG...
S'AUGAUUUUGUACCCAGCCAAAGAAGGGCGAUGA 3' mRNA Codon AUG - start codon AUU Corresponding Amino Acid MET ILE LEU UUG . For the following DNA template strand, determine the mRNA strand and the polypeptide chain DNA 3' TACTTCCCAAAGCGCTACCCGGCAATC 5 RNA Polypeptide Chain • For the following DNA template strand, determine the mRNA strand, the polypeptide chain and the tRNA anti-codons. DNA 3' TACCGTTCCTTACTAACGGTTCTCCCTATT 5 Alaud dha falla una line and now thanenin muth
If the DNA template strand sequence at a particular region of a gene is 3-GGA-5. What...
If the DNA template strand sequence at a particular region of a gene is 3-GGA-5. What amino acid would this result in after transcription and translation? Pro (Proline) Ser (Serine) Val (Valine) Arg (Arginine) Question 20 1 pts What is created during transcription? a strand of codons O a strand of tRNA a strand of anticodons a polypeptide • a strand of DNA IPS Which letter (representing a phase of the cell cycle) would you observe (S phase) synthesis and...
If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give the sequence of the template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (b) Give the sequence of the non-template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (c) Give the amino acid sequence. (1.5 marks) You will require the following genetic code to answer this question. Second letter с...
can i get help with this question please
Reference Sequence Wild-Type DNA Template Sequence: mRNA Sequence: Amino Acid Sequence: TAC ACC TTG GCG ACG ACT AUG UGG AAC CGC UGC UGA Met-Top-Asn--Ars--Y-STOP NS. Mutated DNA Template Sequence #5: TAC ACC TTG GGA CGA CT Compare the mutated DNA#5 with the wild-type DNA sequence. Do you observe a substitution, deletion, or insertion mutation? The mRNA sequence derived from mutated DNA #5 is AUG UGG AAC CCU GCU GA Use Table 10.3...
Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5' and 3' ends) for each mutated DNA sequence, then transcribe (indicating 5' and 3' ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid...
B) If this mRNA is translated beginning with the
first AUG codon in its sequence, what is the N-terminal
amino acid sequence of the protein that it encodes?
can you help me solve A and B
The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... a What is the nucleotide sequence of the DNA template strand from which it was transcribed? The Standard Genetic Code AAA Lysine CAA Glutamine GAA Glutamate UAA stop AAC Asparagine CAC | Histidine GAC Aspartate UAC...
15. Determine the amino acids following mRNA molecules. ne the amino acid sequence a ribosome would translate from the *GCACCAUGCAAAGCGGGGAUUAGACCUUU-3 Caution: from which end of the RNA strand does the ribosome begin translating? 3-AGAGUCCAUGCAAAGCGGGGAUUGUACCUUU - 5' 16. Determine the amino acid sequence a ribosome would translate from the following non template DNA strand. (Hint: you must first convert the non template DNA strand to a template DNA strand and then to mRNAJ 3'-ACCTTGATCCTTGACGTATGTAGTATGTATC-5'
S'AUGAUUUUGUACCCAGCCAAAGAAGGGCGAUGA 3' mRNA Codon AUG - start codon AUU Corresponding Amino Acid MET ILE LEU UUG . For the following DNA template strand, determine the mRNA strand and the polypeptide chain DNA 3' TACTTCCCAAAGCGCTACCCGGCAATC 5 RNA Polypeptide Chain • For the following DNA template strand, determine the mRNA strand, the polypeptide chain and the tRNA anti-codons. DNA 3' TACCGTTCCTTACTAACGGTTCTCCCTATT 5 Alaud dha falla una line and now thanenin muth
If the DNA template strand sequence at a particular region of a gene is 3-GGA-5. What amino acid would this result in after transcription and translation? Pro (Proline) Ser (Serine) Val (Valine) Arg (Arginine) Question 20 1 pts What is created during transcription? a strand of codons O a strand of tRNA a strand of anticodons a polypeptide • a strand of DNA IPS Which letter (representing a phase of the cell cycle) would you observe (S phase) synthesis and...
Most questions answered within 3 hours.
-
Katelynn, a physician, earns $200,000 from her medical practice
in the current year. She receives $45,000...
asked 1 minute ago -
Each row of the table below describes an aqueous solution at
25°C
.
The second column...
asked 6 minutes ago -
A horizontal wire is at y = 0. Current travels in the +x
direction. The magnetic...
asked 6 minutes ago -
Let X be a continuous random variable whose PDF is Let X be a
continuous random...
asked 27 minutes ago -
Martinez Company’s relevant range of production is 7,500 units
to 12,500 units. When it produces and...
asked 25 minutes ago -
A football with a mass of 1.2 kg is kicked from ground level to
a height...
asked 31 minutes ago -
Remember: Changes in supply determinants shift supply, and
changes in demand determinants shift demand. We say...
asked 29 minutes ago -
Why is the answer b), for this question? I came up with C) for
my incorrect...
asked 36 minutes ago -
Suppose that you know that in the population of full-time
employees in the United States, the...
asked 57 minutes ago -
This experiment was designed originally to sample various meat and carcass quality
aspects of Ontario pigs...
asked 58 minutes ago -
Dopamine Hydrochloride: draw the structure And Show the
functional groups in different colors and label the...
asked 50 minutes ago -
A rope supports a 10 kg dumbbell hanging from it. What is the
tension in the...
asked 50 minutes ago