Question
please help
Protein synthesis proceeds in which direction? a. from the C-terminus to the N-terminusa b. from the middle towards the two
0 0
Add a comment Improve this question Transcribed image text
Answer #1

In the molecule of a peptide, the amino acid residue on one end has an amine group on the alpha carbon. This amino acid residue is called the N-terminal of the peptide. The amino acid residue on the other end has a carboxylic acid group on the alpha carbon. This amino acid is called the C-terminal.

eg:

a a = CH3 CH(CH3)2 CH SH N-terminal C-terminal

When the structure of a peptide is drawn horizontally, by convention, the N-terminal is placed on the left and the C-terminal on the right.

amino acid residue amino acid residue amino acid residue amino acid residue amino acid residue A A N-terminal C-terminal pept

so as we know direction of protein synthesis is from N terminus to C terminus so the correct option is c.

hope you like the answer if you have any doubt please comment it

Add a comment
Know the answer?
Add Answer to:
please help Protein synthesis proceeds in which direction? a. from the C-terminus to the N-terminusa 'b....
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Which of the following are true of the synthesis/construction of a protein? Pick ALL that apply. A. ester bonds are...

    Which of the following are true of the synthesis/construction of a protein? Pick ALL that apply. A. ester bonds are formed B. it produces water C. it is synthesized from C-terminus to N-terminus D. it can rotate around the peptide bond E. amide bonds are formed F. peptide bonds are formed

  • Which statement about acetylation is false? a. A protein may be acetylated at the N' terminus...

    Which statement about acetylation is false? a. A protein may be acetylated at the N' terminus by acetyltransferase D. A protein may be acetylated on a lysine R group by an acetyltransferase C. Acetylation is not reversible. d. Acetylation may induce a conformation change in the protein. QUESTION 2 True/False: All proteins that are ubiquitinated are sent to the proteasome and degraded True False QUESTION 3 If a hydrolytic enzyme of the lysosome escapes and enters the cytosol, it will...

  • please answer me this Consider a membrane protein destined for the plasma membrane. From a hydropathy...

    please answer me this Consider a membrane protein destined for the plasma membrane. From a hydropathy plot, you determine the protein has the following general structural elements: • • • 5 Trans-membrane domains (boxes 1-5) 6 soluble domains (wavy lines A-F) Flanking charges around trans-membrane domain 1. (A positive charge is towards the N-terminus, and a negative charge is towards the C-terminus.) You find that soluble domains B and E contain possible glycosylation sites. Ntorm in an ammo u arom...

  • O ACTIVITY 5.4.1 Synthesis of a Protein: A Simulation Activity In this activity, you will be...

    O ACTIVITY 5.4.1 Synthesis of a Protein: A Simulation Activity In this activity, you will be provided with the DNA nucleotide sequence that codes for a hypothetical protein. The code will be provided to you in three fragments. You will have to tran- scribe the code into mRNA, remove an intron segment, and translate the mRNA into the protein. In addition, you will have to identify the beginning fragment the middle fragment, and the end fragment. Sequence A TCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGC CGCCAGGGCCCCGCCCCTCAGAAGTTGGT...

  • 21. Which of the following would NOT change the structure and function of a protein A...

    21. Which of the following would NOT change the structure and function of a protein A Methylation of a protein B. Lipid modification of a protein C Change in the length of the Poly A tail of the mRNA transcript encoding a protein D. Change in the position of reactive amino acids E. Proteolysis 22. Two peptides have almost the exact same primary structure, except that one has about 10 fewer amino acids at the amino-terminus (N-terminus) of the protein....

  • Part B. Stes of protein synthesis n the All proteins are thesized by boomes in the...

    Part B. Stes of protein synthesis n the All proteins are thesized by boomes in the Som m es o endomembrane system or pass through it and are secreted to the Which of the following proteins are systed by bound Select all that apply View All bomo protein DER protein actin

  • Which of the following scenarios will lead to the protein to be secreted out of the...

    Which of the following scenarios will lead to the protein to be secreted out of the cell? Select one: a. A protein, normally localized to the Golgi apparatus, to which the Signaling peptide is deleted b. More than one of the describe scenarios will cause the protein to be secreted outside the cell c. A protein that is normally secreted, to which its Signaling peptide is deleted and replaced with a PLS d. A protein normally localized to the nucleus,...

  • Which of the following scenarios will lead to the protein to be secreted out of the...

    Which of the following scenarios will lead to the protein to be secreted out of the cell? Select one: a. A protein that is normally secreted, to which its Signaling peptide is deleted and replaced with a PLS b. More than one of the describe scenarios will cause the protein to be secreted outside the cell c. A protein, normally localized to the Golgi apparatus, to which the Signaling peptide is deleted d. A protein that is normally localized to...

  • please help me with these Force 1,560 N acts from A towards B m (The line...

    please help me with these Force 1,560 N acts from A towards B m (The line of action for does not pass through O. That illusion occurs due to the isometric drawing, Express your answer in Determine the moment of the force about point in N vector form.) Determine the shortest distance from point to the line of action of the force in mm Force F = 658 lb acts from A towards B. Determine the moments of the force...

  • please please i need help with a,b,,c A 14.0 m uniform ladder weighing 490 N rests...

    please please i need help with a,b,,c A 14.0 m uniform ladder weighing 490 N rests against a frictionless wall. The ladder makes a 63.0-angle with the horizontal (a) Find the horizontal and vertical forces (in N) the ground exerts on the base of the ladder when an 830-N firefighter has climbed 3.80 m along the ladder from the botto horizontal force magnitude direction 239.62 towards the wall vertical force magnitude 239.62 What forces act in the vertical direction? N...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT