Describe how dideoxynucleotides are used for sequencing DNA.
Describe how dideoxynucleotides are used for sequencing DNA.
Homework Answers
dideoxynucleotides are used for sequencing DNA (ddNTPs such as ddATP, ddCTP, ddTTP and ddGTP)
Sanger's method utilizes ddNTPs, DNA pol, single stranded DNA template and RNA primer. It actually utilized for chain termination.
ddNTPs are specially designed nucleotides have H attached to 3' carbon. This method causes chain termination as ddNTPs does not form the phosphodiester bond with the next deoxynucleotide. Here ddNTPs are fluorescently or radiolabeled.
In 4 samples of reaction, different(separately) ddNTPs are added along with normal dNTPs. This is followed by DNA extension by bound primer and then DNA fragments get heat denatured separated by size by gel electrophoresis. The DNA bands then visualized by autoradiography or by UV and the DNA sequence can easily be read off X-ray film or gel image.
-Explain how DNA sequencing can be used to identify organisms and place them into phylogenetic trees...
-Explain how DNA sequencing can be used to identify organisms and place them into phylogenetic trees or "trees of life". -Why would whole genome sequencing be better than sequencing parts of the bird genomes? -Besides humans, what group of animals would you recommend sequencing next and why? Justify your answer with some reasons.
3. A primer used in dideoxy DNA sequencing is 5’GGATCCATGACTAGTCCGAC-3’. A segment of DNA is cloned...
3. A primer used in dideoxy DNA sequencing is 5’GGATCCATGACTAGTCCGAC-3’. A segment of DNA is cloned into a vector and then the vector DNA is denatured and subjected to dideoxy DNA sequencing method. Below is the DNA sequence from a region of the vector. 5’GGGCTAGCCGGATCCATGACTAGTCCGACTTACTGACCATCGACTCATCC-3’ 3-CCCGATCGGCCTAGGTACTGATCAGGCTGAATGACTGGTAGCTGAGTAGG-5’ To which DNA strand does the primer bind, the top or bottom one? Based on the sequence above, what would be the sizes of the bands (i.e., the number of nucleotides in each band)...
How has DNA-sequencing technology evolved in response to the emerging needs of genome scientists? Drag the...
How has DNA-sequencing technology evolved in response to the emerging needs of genome scientists? Drag the terms on the left to the appropriate blanks on the right to complete the sentences. Not all terms will be used. Reset Help reduce speed sequencing methods, a single serves as a template. In one such strategy, the DNA polymerase is tethered in a nanopore and fluorescently labeled nucleotides are detected as they are incorporated. The overall goal is to and accuracy of sequencing...
09. Describe specific molecular techniques that detect DNA, mRNA or polypeptide. Identify specific probes used for...
09. Describe specific molecular techniques that detect DNA, mRNA or polypeptide. Identify specific probes used for the detection of the corresponding macromolecules. Is there a technique available to identify a protein that interacts with DNA sequence? (10 points) Q10A. Differentiate between two types of DNA sequencing methodologies, sequencing by chain termination and next generation sequencing. (5 points)
The following is a DNA sequencing gel where the different dideoxynucleotides have fluorescent labels that cause...
The following is a DNA sequencing gel where the different dideoxynucleotides have fluorescent labels that cause them to emit a different colour. In this case A = red/triangle, T = green, G = purple/circle and C = black. Based on the image of the gel, what was the sequence of synthesized strand? (The top of the gel is where the DNA was loaded - the negatively charged end) IDOL O III ODDITIO Select one: O a. 3'GACAAGCTTCGTACCAACAGGTCT 5' O O...
Why are next-generation DNA sequencing technologies known as sequencing-by-synthesis? Why are next-generation DNA sequencing technologies known...
Why are next-generation DNA sequencing technologies known as sequencing-by-synthesis? Why are next-generation DNA sequencing technologies known as sequencing-by-synthesis? The complete DNA strands are synthesized then sequenced. Numerous synthesized fragments of DNA are sequenced to determine which nucleotides were incorporated. The sequencing occurs during S phase of the cell cycle. RNA molecules are synthesized off of the DNA templates and the incorporated nucleotides are then determined. Incorporated nucleotides are determined while they are being added to a growing DNA strand.
Q1) List the limitations and challenges of dideoxy termination method of DNA sequencing? Q2) In the...
Q1) List the limitations and challenges of dideoxy termination method of DNA sequencing? Q2) In the context of mutation detection, describe the differences between first- and second-generation sequencing? Q3) 6-year-old child presenting with sensorineural deafness, sequencing of MYO15A gene by Sanger method was performed and showed the following chromatogram: A- Describe the principle of Sanger sequencing method? B- Describe the DNA change: position, type of variant and genotype?
The following strand of DNA is to be used for sequencing: 3'CGACTGACTCGACGGCCTAGCTATAG. The primer is CTGACTG....
The following strand of DNA is to be used for sequencing: 3'CGACTGACTCGACGGCCTAGCTATAG. The primer is CTGACTG. The number of DNA fragments resulting from a tube containing all the normal deoxyribonucleotides along with dideoxyCTP added is expected to be: 06 05 08
DNA Sequencing Techniques Compare/contrast Sanger sequencing, pact-bio, and oxford nanopore sequencing techniques. Include how to make...
DNA Sequencing Techniques Compare/contrast Sanger sequencing, pact-bio, and oxford nanopore sequencing techniques. Include how to make a library, and why you would use each one in respect to cost, size, % error, etc. Consider budget, what you want to get out of it, and is there merit to combine different technologies together?
Dideoxy nucleotides that are used in DNA sequencing experiments terminate DNA synthesis because they: cannot be...
Dideoxy nucleotides that are used in DNA sequencing experiments terminate DNA synthesis because they: cannot be recognized by DNA polymerases and therefore are not incorporated during synthesis. have no 3′ -OH group and so no additional nucleotides can be added after these nucleotides are incorporated. have no phosphate groups. are only recognized by reverse transcriptases. have methyl groups attached to the 5′ position of the sugar and cannot be incorporated during synthesis.
How has DNA-sequencing technology evolved in response to the emerging needs of genome scientists? Drag the terms on the left to the appropriate blanks on the right to complete the sentences. Not all terms will be used. Reset Help reduce speed sequencing methods, a single serves as a template. In one such strategy, the DNA polymerase is tethered in a nanopore and fluorescently labeled nucleotides are detected as they are incorporated. The overall goal is to and accuracy of sequencing...
09. Describe specific molecular techniques that detect DNA, mRNA or polypeptide. Identify specific probes used for the detection of the corresponding macromolecules. Is there a technique available to identify a protein that interacts with DNA sequence? (10 points) Q10A. Differentiate between two types of DNA sequencing methodologies, sequencing by chain termination and next generation sequencing. (5 points)
The following is a DNA sequencing gel where the different dideoxynucleotides have fluorescent labels that cause them to emit a different colour. In this case A = red/triangle, T = green, G = purple/circle and C = black. Based on the image of the gel, what was the sequence of synthesized strand? (The top of the gel is where the DNA was loaded - the negatively charged end) IDOL O III ODDITIO Select one: O a. 3'GACAAGCTTCGTACCAACAGGTCT 5' O O...
The following strand of DNA is to be used for sequencing: 3'CGACTGACTCGACGGCCTAGCTATAG. The primer is CTGACTG. The number of DNA fragments resulting from a tube containing all the normal deoxyribonucleotides along with dideoxyCTP added is expected to be: 06 05 08
Most questions answered within 3 hours.
-
Test the claim that the proportion of people who own cats is
smaller than 50% at...
asked 1 minute from now -
Question 1 Continues
*** This is the NODE ADT you need. I hope this will help...
asked 26 seconds ago -
Show the rearrangements of the carbon skeleton in the following
carbocations. Note that in some cases...
asked 2 hours ago -
Use a z -Table to find the specified area.
Between the mean and 3.01 deviations from...
asked 2 hours ago -
Consider the following reaction at equilibrium. What will happen
if O2 is added to the reaction?...
asked 3 hours ago -
Based on how much or how little you have noticed in the media,
do you think...
asked 5 hours ago -
I calculate Rosetta Stone’s P/E ratio as 10x prior to a report
about future industry growth....
asked 7 hours ago -
What major physiological changes account for electrodermal
activity (as in during a lie-detector test)?
asked 8 hours ago -
You are going to sell fruits & vegetables at a local
roadside market. List separately and...
asked 8 hours ago -
Hows does water affect the digestion of fats ?
asked 10 hours ago -
A buffer that contains 0.41 M of a base, B and 0.21 M of its
conjugate...
asked 11 hours ago -
Pleaaaaaaaasssssse help me please please it's more important
:((((((((((((((((((((
CASE STUDY
Nissan Company
Nissan Motor Company,...
asked 11 hours ago