Homework Answers
Answer: The correct answer is option 2nd, i.e., 5 fragments will be produced in tube. Explanation is attached below in handwritten:
Add Answer to:
The following strand of DNA is to be used for sequencing: 3'CGACTGACTCGACGGCCTAGCTATAG. The primer is CTGACTG....
3. A primer used in dideoxy DNA sequencing is 5’GGATCCATGACTAGTCCGAC-3’. A segment of DNA is cloned...
3. A primer used in dideoxy DNA sequencing is 5’GGATCCATGACTAGTCCGAC-3’. A segment of DNA is cloned into a vector and then the vector DNA is denatured and subjected to dideoxy DNA sequencing method. Below is the DNA sequence from a region of the vector. 5’GGGCTAGCCGGATCCATGACTAGTCCGACTTACTGACCATCGACTCATCC-3’ 3-CCCGATCGGCCTAGGTACTGATCAGGCTGAATGACTGGTAGCTGAGTAGG-5’ To which DNA strand does the primer bind, the top or bottom one? Based on the sequence above, what would be the sizes of the bands (i.e., the number of nucleotides in each band)...
How does DNA synthesis along the lagging strand differ from that of the leading strand? a....
How does DNA synthesis along the lagging strand differ from that of the leading strand? a. nucleotides are added to the 5' end instead of the 3' end b. an RNA primer is needed on the lagging strand but not on the leading strand c. ligase is the enzyme that polymerizes DNA on the lagging strand d. okazaki fragments, which each grow 5' to 3', must be joined along the lagging strand
In order to sequence a strand of DNA, all four dNTPs, ddGTP, DNA polymerase and primers...
In order to sequence a strand of DNA, all four dNTPs, ddGTP, DNA polymerase and primers (5’ ACTGA 3’) are added to a test tube. A template strand of DNA is shown below. How many fragments of different lengths would you have at the end of the sequencing process? (write down the sequence of each fragment and the length of the fragment for full credit) DNA Sequence 3’ TGACTCTAGCCTAGGACTATATCG 5’
9. In order to sequence a strand of DNA, all four dNTPs, ddGTP, DNA polymerase and...
9. In order to sequence a strand of DNA, all four dNTPs, ddGTP, DNA polymerase and primers (5' ACTGA 3') are added to a test tube. A template strand of DNA is shown below. How many fragments of different lengths would you have at the end of the sequencing process? (write down the sequence of each fragment and the length of the fragment for full credit)- 2.5pts DNA Sequence 3'TGACTCTAGCCTAGGACTATATCG 5'
Which of the following is true regarding DNA sequencing? (multiple answers possible) a. Next generation sequencing...
Which of the following is true regarding DNA sequencing? (multiple answers possible) a. Next generation sequencing is limited to simultaneous sequencing of 23 different nucleotide chains at a time b. Next generation sequencing or “sequencing by synthesis”, requires ddNTPs c. DNA fragments generated by the Sanger sequencing reaction each contain a primer incorporated at the 5’ end of the nucleotide chain. d. Primers are labeled with different flurophores allowing all 4 chain termination reactions for Sanger sequencing to be combined...
The following primer sequence was used in a Sanger sequencing reaction along with the following template,...
The following primer sequence was used in a Sanger sequencing reaction along with the following template, how many different products would be expected if the only dideoxynucleotide being used was ddTTP? Primer: 5’ TGGCGCGC 3’ Template: 5’ TGGCGCGCATGGTTTAGCGCGCCA 3’ a. 6 b. 5 c. 4 d. 3 e. 2
The following diagram represents a replication bubble associated with DNA synthesis. Based on this diagram, select...
The following diagram represents a replication bubble associated
with DNA synthesis. Based on this diagram, select all of the
options below that are true.
1 | 2 ---- Quadrants 1 and 4 are associated with lagging strand synthesis Quadrants 1 and 4 are associated with leading strand synthesis Quadrants 1 and 2 are associated with lagging strand synthesis Quadrants 3 and 4 are associated with lagging strand synthesis Synthesis of both daughter strands is completely continuous Telomerase activity is needed...
the following Sequence of DNA was mixed with an unknown primer of length 15 BP, ddC, the four NTPs and DNA polymerase. the resulting mixture of DNA fragments were separated to provide fragments of...
the following Sequence of DNA was mixed with an
unknown primer of length 15 BP, ddC, the four NTPs and DNA
polymerase. the resulting mixture of DNA fragments were separated
to provide fragments of lengths 23, 24, 28, and 32 BP amongst
others (other fragments were observed but are not indicated).
indicate below the sequence of the 15 bo primer from 5' to 3'.
please explain how to do this
d) The following sequence of DNA TTGCTCGACTGGACCTCACTGACACGA TCGCA TCCTTCGACTCGT was...
If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the...
If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the following sequence o 3-AATGCTAC-5' 3'-CATCGTAA-5 3-GTAGCATT-5 3-TTACGATG-5 Question 2 20 pts Which of the following does the enzyme primase make? phosphodiester linkages (bonds) Okazaki fragments RNA primer DNA primer In which direction does DNA replication take place? 3'to 5 5'to 5 5'to 3 3'to 3 Question 4 20 pts Which enzyme unwinds the double-stranded helical DNA starting at the origin of replication? ligase primase...
the options are : leading strand, 5’end of new DNA strand, 3’ end of new DNA...
the options are : leading strand, 5’end of new DNA strand, 3’
end of new DNA strand, 5´end of parentsl DNA strand, RNA primer, 3’
end of parental DNA strand, RNA transcript, lagging strand and
DNA.
The image below shows DNA replication; certain parts of the image are labelled with letters. Match the letter to its correct will be used). B. 5' end of parental DNA strand 3' end of parental DNA strand leading strand RNA primer
9. In order to sequence a strand of DNA, all four dNTPs, ddGTP, DNA polymerase and primers (5' ACTGA 3') are added to a test tube. A template strand of DNA is shown below. How many fragments of different lengths would you have at the end of the sequencing process? (write down the sequence of each fragment and the length of the fragment for full credit)- 2.5pts DNA Sequence 3'TGACTCTAGCCTAGGACTATATCG 5'
The following diagram represents a replication bubble associated
with DNA synthesis. Based on this diagram, select all of the
options below that are true.
1 | 2 ---- Quadrants 1 and 4 are associated with lagging strand synthesis Quadrants 1 and 4 are associated with leading strand synthesis Quadrants 1 and 2 are associated with lagging strand synthesis Quadrants 3 and 4 are associated with lagging strand synthesis Synthesis of both daughter strands is completely continuous Telomerase activity is needed...
the following Sequence of DNA was mixed with an
unknown primer of length 15 BP, ddC, the four NTPs and DNA
polymerase. the resulting mixture of DNA fragments were separated
to provide fragments of lengths 23, 24, 28, and 32 BP amongst
others (other fragments were observed but are not indicated).
indicate below the sequence of the 15 bo primer from 5' to 3'.
please explain how to do this
d) The following sequence of DNA TTGCTCGACTGGACCTCACTGACACGA TCGCA TCCTTCGACTCGT was...
If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the following sequence o 3-AATGCTAC-5' 3'-CATCGTAA-5 3-GTAGCATT-5 3-TTACGATG-5 Question 2 20 pts Which of the following does the enzyme primase make? phosphodiester linkages (bonds) Okazaki fragments RNA primer DNA primer In which direction does DNA replication take place? 3'to 5 5'to 5 5'to 3 3'to 3 Question 4 20 pts Which enzyme unwinds the double-stranded helical DNA starting at the origin of replication? ligase primase...
the options are : leading strand, 5’end of new DNA strand, 3’
end of new DNA strand, 5´end of parentsl DNA strand, RNA primer, 3’
end of parental DNA strand, RNA transcript, lagging strand and
DNA.
The image below shows DNA replication; certain parts of the image are labelled with letters. Match the letter to its correct will be used). B. 5' end of parental DNA strand 3' end of parental DNA strand leading strand RNA primer
Most questions answered within 3 hours.
-
Ammonia will decompose into nitrogen and hydrogen at high
temperature. An industrial chemist studying this reaction...
asked 4 minutes ago -
10. Complete the table below
only using hexadecimal numbers:
AL CODE
EBX
EAX
[EAX]
mov eax,...
asked 22 minutes ago -
trust is best established through the combination of ------and
------- .
1. magnanimity and justice
2....
asked 37 minutes ago -
Blood pressure is normally taken on the upper arm at the level
of the heart. Suppose,...
asked 36 minutes ago -
Suppose that the satellite around the earth has an orbit that is
24 KM larger in...
asked 39 minutes ago -
Calculate the [OH (aq)] in limes which have a [H3O*(aq)] of 1.3 x
10 mol/L
asked 37 minutes ago -
A nozzle with a radius of 0.250 cm is attached to a garden hose
with a...
asked 49 minutes ago -
PLEASE do not use any loops for the program; only recursion is
allowed
4. Write a...
asked 57 minutes ago -
Please help me with me. I did the first part to write the operations but in...
asked 54 minutes ago -
Use Cryptool to find the Cryptographic SHA-1 hash value of the
string "abc". The calculator is...
asked 59 minutes ago -
You are attempting to calculate a firm’s free cash flow to
equity. You know the following...
asked 1 hour ago -
the following reaction occurs in a balloon containing
N2O2 gas
N2O4(g)=2NO2(g)
will the volume of the...
asked 2 hours ago