Question

The following is a DNA sequencing gel where the different dideoxynucleotides have fluorescent labels that cause them to emit

Select one: O a. 3GACAAGCTTCGTACCAACAGGTCT 5 O O O b.5 CTGTTCGAAGCATGGTTGTCCAGA 3 C3 CTGTTCGAAGCATGGTTGTCCAGA 5 d. 5GAC

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Option b

DNA sequencing is the procedure of determining the sequence of the nucleic acid. A method or technique that determines the order of the four bases: adenine, guanine, cytosine, and thymine. The major sequencing methods employed are- Maxam Gilbert sequencing and Sanger sequencing/chain termination method (Here dideoxynucleotides are incorporated by the DNA polymerase during the process of replication in vitro.). Nowadays, automated sequencing is used.

In the given gel the base A is denoted by red/triangle

G=purple/circle

C=Black

T=Green

The direction of electrophoresis will be from negative electrode (as DNA is negatively charged) to the positive electrode, i.e, from top of the gel to the bottom of the gel. The resulting sequence will be read from bottom to top direction or 5’ to 3’ direction.

The sequence will be as given in option b.

Add a comment
Know the answer?
Add Answer to:
The following is a DNA sequencing gel where the different dideoxynucleotides have fluorescent labels that cause...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 9. (8 points) Use the figure below to answer the following questions about Sanger Dideoxy sequencing....

    9. (8 points) Use the figure below to answer the following questions about Sanger Dideoxy sequencing. GATC 11.1 This figure represents a portion of a polyacrylamide gel used to separate DNA fragments produced from a Sanger dideoxy DNA sequencing reaction. Write the sequence of the boxed portion of the newly synthesized (nascent) strand (in the 5' to 3' direction). Label the 5' and 3' ends of the DNA sequence. 11 il Write the DNA sequence of the complementary template strand...

  • QUESTION 31 The gel below shows the result of sequencing a piece of DNA (the "template")....

    QUESTION 31 The gel below shows the result of sequencing a piece of DNA (the "template"). Each lane shows the fragments of the new strand (the "daughter" strand) that are produced when a given ddNTP is added to the PCR reaction. Based on these results, what is the sequence of the template (original) DNA strand? Please write (type) it out, making sure you indicate the 5' and 3" ends ddATP ddTTP ddCTP ddGTP well well well well save Click Save...

  • If you wish to sequence a long strand of DNA in one round of reactions, you...

    If you wish to sequence a long strand of DNA in one round of reactions, you should: O A. Decrease the ddNTP/dNTP ratio O B. Increase the ddNTP/dNTP ratio O C. Use a shorter DNA primer O D. Add twice as much primer Based on this figure, the most likely error is: O A. The scientist forgot to add dNTPs to one of the reaction tubes. O O B. <label for="q7_4" id="lq7_4">The scientist did not denature the DNA strands</label> O...

  • The “TOP” of the gel depicted below is where the 4 separate reactions were loaded for...

    The “TOP” of the gel depicted below is where the 4 separate reactions were loaded for sequence determination. Which of the following is true regarding the image below? a. The largest/longest nucleotide chains are at the top of the image b. The largest/longest nucleotide chains are at the bottom of the image c. A negatively charged electrode will be placed at the “BOTTOM” to run the DNA through the ge d. The 5’ end of each DNA chain contains a...

  • The following diagram represents a replication bubble associated with DNA synthesis. Based on this diagram, select...

    The following diagram represents a replication bubble associated with DNA synthesis. Based on this diagram, select all of the options below that are true. 1 | 2 ---- Quadrants 1 and 4 are associated with lagging strand synthesis Quadrants 1 and 4 are associated with leading strand synthesis Quadrants 1 and 2 are associated with lagging strand synthesis Quadrants 3 and 4 are associated with lagging strand synthesis Synthesis of both daughter strands is completely continuous Telomerase activity is needed...

  • In DNA sequencing, ddNTPs differ from dNTPs in that ddNTPs are lacking a OH at the...

    In DNA sequencing, ddNTPs differ from dNTPs in that ddNTPs are lacking a OH at the a. 2' carbon b. 5' carbon c. 3' carbon please answer as many as you can!! I am low on questions and could use the help! Mother || Child II Male 1 Male 2 Results from a paternity test using DNA fingerprinting is shown. DNA was isolated from a mother, her child and 2 potential fathers. Primers designed to amplify different satellite DNA regions...

  • This PCR step is called annealing. The annealing step follows the denaturation step: it is usually...

    This PCR step is called annealing. The annealing step follows the denaturation step: it is usually the lowest temperature in the PCR. The temperature of this step varies with each PCR reaction because each primer has its own sequence and may not be an identical match to the DNA template strand. GC or CG have three hydrogen bonds and AT or TA have two hydrogen bonds. Higher annealing temperatures are more stringent and require a better match between primer and...

  • is a nucleus the sole source of DNA in a eukaryotic cell? WORKSHEET: EXERCISE 10 NAME:...

    is a nucleus the sole source of DNA in a eukaryotic cell? WORKSHEET: EXERCISE 10 NAME: DATE: SECTION Twenty microliters (20 ㎕) of each sample was loaded into your gel. Convert 2OuL to milliliters (mL). I. 2. Describe the charge on the DNA molecule and specify which component of the molecule is responsible for contributing to that charge. Why do some DNA samples travel further in the gel than others? 3. 4. Once electrophoresed, how are the DNA bands visualized?...

  • and w Two-dimensional gel electrophoresis separates proteins based on a. shape; charge Ob.size; concentration c. concentration;...

    and w Two-dimensional gel electrophoresis separates proteins based on a. shape; charge Ob.size; concentration c. concentration; shape O d. size, charge O e. size; shape Refer to the table. Several strains of a bacterium are sequenced to investigate the pan and core genomes. In the table, + denotes presence of the gene and denotes its absence. Gene Gene Gene Gene Gene Strain ! Strain 2 + Strain 3 + Strain 4 + + + + Strain 5 + + What...

  • Chromosomal and plasmid DNA can be cut into manageable pieces by restriction enzymes. Using agarose gel...

    Chromosomal and plasmid DNA can be cut into manageable pieces by restriction enzymes. Using agarose gel electrophoresis, the DNA fragments can be separated on a gel, based on their lengths. In order to see the fragments, a stain is typically added to the gel. The size of each fragment can be determined by comparing each one to a DNA molecular weight marker of known size. Below is a map of pBR22 plasmid. The position and base pair number of the...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT