The strategy for obtaining a genomic sequence can be divided into four steps: 1) overlap contigs...
The strategy for obtaining a genomic sequence can be divided into four steps:
1) overlap contigs for complete sequence,
2) sequence each fragment,
3) cut many genome copies in to random fragments,
4) overlap sequence reads.
What is the order of the four steps?
A) 1, 2, 3, and 4
B) 2, 4, 3, and 1
C) 3, 2, 1, and 4
D) 3, 2, 4, and 1
E) 4, 3, 2, and 1
Homework Answers
Add Answer to:
The strategy for obtaining a genomic sequence can be divided
into four steps:
1) overlap contigs...
Below are four reads from the same genome (all sequences are shown in the 5’→3’ direction)....
Below are four reads from the same genome (all sequences are shown in the 5’→3’ direction). Assemble them into one continuous sequence. What is the order of the fragments? Fragment #1: CCGGTATGTGTGTGTG Fragment #2: CGTACGTGGGGGAAA Fragment #3: ATGCGATCGTACG Fragment #4: ATACCGGTTTCCCCC A. 1-2-3-4 B. 1-3-2-4 C. 1-4-3-2 D. 2-1-4-3 E. 2-3-1-4 F. 2-4-3-1 G. 3-1-4-2 H. 3-2-4-1 I. 3-4-2-1 J. 4-1-2-3 K. 4-2-1-3 L. 4-3-1-2
And.. Exercise1: Give the basic steps involved in extracting genomic DNA from animal cells and tossues?...
And..
Exercise1:
Give the basic steps involved in extracting genomic
DNA from animal cells and tossues?
23- Which of the following statements is correct? a. Longer DNA fragments migrate farther than shorter fragments. b. Migration distance is inversely proportional to the fragment size. c. Positively charged DNA migrates more rapidly than negatively charged DNA. d. Uncut DNA migrates farther than DNA cut with restriction enzymes. 24- Why do scientists load DNA of known sizes (also called "marker" or "ladder") into...
The following is a small part of a vector DNA sequence showing the NdeI and SacII...
The following is a small part of a vector DNA sequence showing
the NdeI and SacII cut sites. The
bases recognizedby the enzymes are in bold. They both are Class II
restriction enzymes. These enzymes recognize a specific sequence of
palindromic bases, i.e., reads the same on both strands
1. When you cut this DNA, shown in the figure above, by
NdeI, it will generate sticky ends. Write the two pieces
of DNA that will result after NdeI digestion and...
Suppose you digest the genomic DNA of a particular organism with the restriction enzyme SauA. Then...
Suppose you digest the genomic DNA of a particular organism with
the restriction enzyme SauA. Then you ligate the resulting fragment
into a unique BamHI cloning site of a plasmid. The sequence of the
restriction sites and position of cleavage is shown below
Note: X and Y and their complementary bases Z and Y’
respectively can be any base (A,C, G, or T)
1) As you can see, ligation is possible because the two restriction
enzymes produce compatible sticky ends....
10. A lab process consists of four steps that can be performed in any sequence. The...
10. A lab process consists of four steps that can be performed in any sequence. The complexity of each task differs. The lab director decides to conduct a study to determine the order of performing the tasks that will result in the lowest number of errors. If he wants to consider all possible orderings of the tasks, how many sequences will be studied?
A DNA sequence has been cut into the three overlapping sequence fragments (in 5'-to-3' orientation) (1)...
A DNA sequence has been cut into the three overlapping sequence fragments (in 5'-to-3' orientation) (1) CCGCGCGTAGCGAGTCAG (2) GGCTAGTTAGCTCCGCGCG (3) AGTCAGTCAAAAT What is the correct assembled sequence of these fragments? a. GGCTAGTTAGCTCCGCGCGTAGCGAGTCAGTCAAAAT b. CCGCGCGTAGCGAGTCAGGGCTAGTTAGCTCCGCGCG OC CCGCGCGTAGCGTTAGCTCCGCGCGCAAAGTCAAAAT d. AGTGATACTAAGATGATGAAGTGATCCACATATAGCGA Oe. AGTCAGTCAAAATGGCTAGTTAGCTCCGCGCGCCGCGC X represents the ratio of the number of protein-coding genes in the typical eukaryote genome to the number of protein-coding genes in the typical prokaryote genome. Y represents the ratio of total genome size in the typical eukaryote to the...
Write true or false ______ 1. The DNA sequence of one human being is on average...
Write true or false ______ 1. The DNA sequence of one human being is on average 99.9% identical to another random human being. ______ 2. As of 2009, all living human beings have had their entire genome sequenced. ______ 3. The nucleotide bases present in a DNA sequence are A, U, G, C. ______ 4. Techniques that enabled scientists to clone genes were developed in the 1970s. ______ 5. A restriction enzyme is useful because it is a generic enzyme...
command 145 Genetics Assignment Genomic Analysis 1. Some bacteria normally produce endonucleases for what purpose? a)...
command 145 Genetics Assignment Genomic Analysis 1. Some bacteria normally produce endonucleases for what purpose? a) necessary digestion of their own genome b) defense against viral infection c) bacteria never make endonucleases naturally 2. A blunt cutter produces DNA fragments with complementary overhanging regions. a) True b) False 3. Which of the following DNA sequences (when double-stranded) most likely represents a restriction endonuclease site for a 6-mer cutter? a) AGTAAGCTTC c) AGAGAGCCAA b) GGTAGATTCC d) None of the above 4....
Question 6. (20 points) You are designing a sequence detector that can detect 0110', if this sequ...
Question 6. (20 points) You are designing a sequence detector that can detect 0110', if this sequence is detected, the detector output a 1'. Please consider 'overlap', which means that even if the sequence '0110 is detected, the detector still can reuse the history data. Design a Mealy FSM. 1) .(5 points) Draw the state transition diagram. 2) (2 points) How many states are there? How many bits are needed to encode the states? 3) -(4 points) Write down the...
1. Why do plasmid vectors contain a polylinker? So that the plasmid can be cut into...
1. Why do plasmid vectors contain a polylinker? So that the plasmid can be cut into many small fragments to be inserted in the region of interest To allow the plasmid to survive on antibiotic media To find a restriction enzyme site that is useful for inserting the fragment of interest Multiple cut sites are required for the DNA fragment to be inserted. 2.What does blue color mean in blue-white screening with pUC18? The DNA fragment was successfully inserted into...
And..
Exercise1:
Give the basic steps involved in extracting genomic
DNA from animal cells and tossues?
23- Which of the following statements is correct? a. Longer DNA fragments migrate farther than shorter fragments. b. Migration distance is inversely proportional to the fragment size. c. Positively charged DNA migrates more rapidly than negatively charged DNA. d. Uncut DNA migrates farther than DNA cut with restriction enzymes. 24- Why do scientists load DNA of known sizes (also called "marker" or "ladder") into...
The following is a small part of a vector DNA sequence showing
the NdeI and SacII cut sites. The
bases recognizedby the enzymes are in bold. They both are Class II
restriction enzymes. These enzymes recognize a specific sequence of
palindromic bases, i.e., reads the same on both strands
1. When you cut this DNA, shown in the figure above, by
NdeI, it will generate sticky ends. Write the two pieces
of DNA that will result after NdeI digestion and...
Suppose you digest the genomic DNA of a particular organism with
the restriction enzyme SauA. Then you ligate the resulting fragment
into a unique BamHI cloning site of a plasmid. The sequence of the
restriction sites and position of cleavage is shown below
Note: X and Y and their complementary bases Z and Y’
respectively can be any base (A,C, G, or T)
1) As you can see, ligation is possible because the two restriction
enzymes produce compatible sticky ends....
10. A lab process consists of four steps that can be performed in any sequence. The complexity of each task differs. The lab director decides to conduct a study to determine the order of performing the tasks that will result in the lowest number of errors. If he wants to consider all possible orderings of the tasks, how many sequences will be studied?
A DNA sequence has been cut into the three overlapping sequence fragments (in 5'-to-3' orientation) (1) CCGCGCGTAGCGAGTCAG (2) GGCTAGTTAGCTCCGCGCG (3) AGTCAGTCAAAAT What is the correct assembled sequence of these fragments? a. GGCTAGTTAGCTCCGCGCGTAGCGAGTCAGTCAAAAT b. CCGCGCGTAGCGAGTCAGGGCTAGTTAGCTCCGCGCG OC CCGCGCGTAGCGTTAGCTCCGCGCGCAAAGTCAAAAT d. AGTGATACTAAGATGATGAAGTGATCCACATATAGCGA Oe. AGTCAGTCAAAATGGCTAGTTAGCTCCGCGCGCCGCGC X represents the ratio of the number of protein-coding genes in the typical eukaryote genome to the number of protein-coding genes in the typical prokaryote genome. Y represents the ratio of total genome size in the typical eukaryote to the...
command 145 Genetics Assignment Genomic Analysis 1. Some bacteria normally produce endonucleases for what purpose? a) necessary digestion of their own genome b) defense against viral infection c) bacteria never make endonucleases naturally 2. A blunt cutter produces DNA fragments with complementary overhanging regions. a) True b) False 3. Which of the following DNA sequences (when double-stranded) most likely represents a restriction endonuclease site for a 6-mer cutter? a) AGTAAGCTTC c) AGAGAGCCAA b) GGTAGATTCC d) None of the above 4....
Question 6. (20 points) You are designing a sequence detector that can detect 0110', if this sequence is detected, the detector output a 1'. Please consider 'overlap', which means that even if the sequence '0110 is detected, the detector still can reuse the history data. Design a Mealy FSM. 1) .(5 points) Draw the state transition diagram. 2) (2 points) How many states are there? How many bits are needed to encode the states? 3) -(4 points) Write down the...
Most questions answered within 3 hours.
-
The tires of a car make 61 revolutions as the car reduces its
speed uniformly from...
asked 3 minutes ago -
Peabody, Inc., sells fireworks. The company’s marketing director
developed the following cost of goods sold budget...
asked 7 minutes ago -
A signal transduction pathway includes the steps listed
below.
1. An inactive signal transduction molecule is...
asked 6 minutes ago -
1. The correlation coefficient determined for two variables has
a value of 0.89. Describe, in words,...
asked 12 minutes ago -
The following data relate to direct materials costs for
November:
Actual costs
4,700 pounds at $5.35...
asked 10 minutes ago -
Kyle, a 95.0 kg football player, leaps straight up into the air
(with no horizontal velocity)...
asked 34 minutes ago -
Which of the following is a measure of profitability?
A.
Quick (acid-test) ratio
B.
Net sales...
asked 37 minutes ago -
Find the total pressure exerted by 2 grams of ethane and 3 grams
of CO2 contained...
asked 38 minutes ago -
A fireman standing on a 5.2 m high ladder operates a water hose
with a round...
asked 34 minutes ago -
A cream formulation is studied for accelerated stability study.
Creaming was observed when formulation was tested...
asked 37 minutes ago -
A 1,150 lumen light bulb is placed 37 cm in front of a mirrored
wall, whose...
asked 48 minutes ago -
Given that z is a standard normal random variable, compute the
following probabilities (to 4 decimals)....
asked 54 minutes ago