Homework Answers
Add Answer to:
Problem 1 Draw a eukaryotic cell and show where DNA and mRNA are located, where proteins...
Assuming transcription and translation are taking place simultaneously, is the cell below a eukaryotic or prokaryotic...
Assuming
transcription and translation are taking place
simultaneously, is the cell below a eukaryotic or
prokaryotic cell? Please explain your answer.
RNA polymerase DNA Ribosome Transcription Polypeptide- Translation MRNA
Describe the three events that occur during pre-mRNA processing in eukaryotic cells, including where these processes...
Describe the three events that occur during pre-mRNA processing in eukaryotic cells, including where these processes take place within the cell.
1.4. In linear eukaryotic DNA, the replication of DNA ends is carried out by a) DNA...
1.4. In linear eukaryotic DNA, the replication of DNA ends is carried out by a) DNA Poll b) DNA Pol III c) Telomerase d) DNA Gyrase 1.5. Based on what we know regarding gene expression, which of the following basic mechanisms of gene expression is most logical? a) DNA → RN → protein b) DNA → MRNA → protein c) mRNA → DNA → rRNA → protein d) DNA → cell [TURN OVER] 1.6. Which of the following processes does...
1. DNA is coiled around what type of proteins to form nucleosomes A. Polymerases DNA replication...
1. DNA is coiled around what type of proteins to form nucleosomes A. Polymerases DNA replication of the lagging strand is discontinuous B. Transcription factors DNA replication of the lagging strand is continuous C. Helicases D. Histones E. DICER 2. Which of the following statements is true? A. DNA replication of the leading strand is discontinuous B. DNA replication of the lagging strand is discontinuous C. DNA replication of the leading strand is dispersive D. DNA replication of the lagging...
Prokaryotic mRNA usually encodes for more than one protein while eukaryotic mRNA a single protein. Eukaryotic...
Prokaryotic mRNA usually encodes for more than one protein while eukaryotic mRNA a single protein. Eukaryotic DNA is linear and bacterial and archaeal DNA is-linear. In prokaryotes, ribosomes attach to the mRNA and start protein synthesis even before transcription is completed. Eukaryotic mRNA, rRNA, and tRNA are all highway processed. Nuclear pore complexes control the entry and exit to and from the nucleus. They will not let mRNA exit the nucleus before it is full processed. Eukaryotic and archaeal DNA...
In the process of translation, mRNA attaches to ribosomes DNA is replicated proteins are synthesized RNA...
In the process of translation, mRNA attaches to ribosomes DNA is replicated proteins are synthesized RNA is synthesized QUESTION 11 What does it mean when we say the genetic code is unambiguous? More than one codon can specify the addition of the same amino acid. The genetic code is different for different domains of organisms. Each codon can specify the addition of only one amino acid. The genetic code is universal (the same for all organisms).
Only answers please don’t show work 33) Viral DNA incorporated into host cell DNA is known...
Only answers please don’t show work
33) Viral DNA incorporated into host cell DNA is known as a/an A) phage. B) envelope C) capsid. 33) 34) How is transformation in bacteria most A) the creation of a strand of RNA from DNA molecule B) the type of semiconservative by DNA C) the infection of cells by a phage DNA molecule D) the e of a strand of DNA from an RNA molecule E) assimilation of external DNA into a cell...
Below is the DNA sequence of a protein-encoding Eukaryotic gene: 5’TAAACGCGATGGACCGACCATACAGTATCGACGCTCCAGGATGGTAAAATAAATGCCT3’ Based on this information, predict...
Below is the DNA sequence of a protein-encoding Eukaryotic gene: 5’TAAACGCGATGGACCGACCATACAGTATCGACGCTCCAGGATGGTAAAATAAATGCCT3’ Based on this information, predict the mature mRNA sequence and the corresponding peptide sequence of this gene after transcription, RNA processing, and translation. Try to recognize and label the sequence features on the primary transcript you learned from the class that are important for Eukaryotic mRNA Processing (e.g. intron sites, poly-A adding site). Please also briefly describe the key steps taking place during RNA processing. For each step of...
pls answer all Question 1: The following figures (Figure 1 and Figure 2) show the structure...
pls answer all
Question 1: The following figures (Figure 1 and Figure 2) show the structure of DNA and of a chromosome. Label each part (A-J) of the figures (hint: D and E refer to the types of bonds formed at these locations) Figure 1. Figure 2. 7 ിപാടിയിലായി CORROS Question 2: The following short sequence of DNA is the sequence of part of a CODING strand of DNA (spaces in sequence are included only for ease of reading). 5'...
Part A What are three observations that suggested eukaryotic RNA was an intermediate between DNA and...
Part A What are three observations that suggested eukaryotic RNA was an intermediate between DNA and protein? Select the three observations. O DNA plays the major role in replication, which allows for sustainable transfer of genetic information. O RNA is transported out of the nucleus and into the cytoplasm where protein translation occurs. Three types of RNA are found in the cell, and all of them are involved in protein synthesis. O DNA is found in the nucleus and protein...
Assuming
transcription and translation are taking place
simultaneously, is the cell below a eukaryotic or
prokaryotic cell? Please explain your answer.
RNA polymerase DNA Ribosome Transcription Polypeptide- Translation MRNA
1.4. In linear eukaryotic DNA, the replication of DNA ends is carried out by a) DNA Poll b) DNA Pol III c) Telomerase d) DNA Gyrase 1.5. Based on what we know regarding gene expression, which of the following basic mechanisms of gene expression is most logical? a) DNA → RN → protein b) DNA → MRNA → protein c) mRNA → DNA → rRNA → protein d) DNA → cell [TURN OVER] 1.6. Which of the following processes does...
1. DNA is coiled around what type of proteins to form nucleosomes A. Polymerases DNA replication of the lagging strand is discontinuous B. Transcription factors DNA replication of the lagging strand is continuous C. Helicases D. Histones E. DICER 2. Which of the following statements is true? A. DNA replication of the leading strand is discontinuous B. DNA replication of the lagging strand is discontinuous C. DNA replication of the leading strand is dispersive D. DNA replication of the lagging...
Prokaryotic mRNA usually encodes for more than one protein while eukaryotic mRNA a single protein. Eukaryotic DNA is linear and bacterial and archaeal DNA is-linear. In prokaryotes, ribosomes attach to the mRNA and start protein synthesis even before transcription is completed. Eukaryotic mRNA, rRNA, and tRNA are all highway processed. Nuclear pore complexes control the entry and exit to and from the nucleus. They will not let mRNA exit the nucleus before it is full processed. Eukaryotic and archaeal DNA...
In the process of translation, mRNA attaches to ribosomes DNA is replicated proteins are synthesized RNA is synthesized QUESTION 11 What does it mean when we say the genetic code is unambiguous? More than one codon can specify the addition of the same amino acid. The genetic code is different for different domains of organisms. Each codon can specify the addition of only one amino acid. The genetic code is universal (the same for all organisms).
Only answers please don’t show work
33) Viral DNA incorporated into host cell DNA is known as a/an A) phage. B) envelope C) capsid. 33) 34) How is transformation in bacteria most A) the creation of a strand of RNA from DNA molecule B) the type of semiconservative by DNA C) the infection of cells by a phage DNA molecule D) the e of a strand of DNA from an RNA molecule E) assimilation of external DNA into a cell...
pls answer all
Question 1: The following figures (Figure 1 and Figure 2) show the structure of DNA and of a chromosome. Label each part (A-J) of the figures (hint: D and E refer to the types of bonds formed at these locations) Figure 1. Figure 2. 7 ിപാടിയിലായി CORROS Question 2: The following short sequence of DNA is the sequence of part of a CODING strand of DNA (spaces in sequence are included only for ease of reading). 5'...
Part A What are three observations that suggested eukaryotic RNA was an intermediate between DNA and protein? Select the three observations. O DNA plays the major role in replication, which allows for sustainable transfer of genetic information. O RNA is transported out of the nucleus and into the cytoplasm where protein translation occurs. Three types of RNA are found in the cell, and all of them are involved in protein synthesis. O DNA is found in the nucleus and protein...
Most questions answered within 3 hours.
-
List and explain why a company would choose to use a
published
compensation survey vs. creating...
asked 3 minutes ago -
A discrete random variable X can take values from 1 to 10. Find
the variance of...
asked 16 minutes ago -
The primary financial goal of a corporation is to maximize:
shareholders wealth.
earnings per share.
stock...
asked 24 minutes ago -
determine whether the vectors u=(1,2,3,), v=(-2,1,0) and
w=(1,0,1) are linearly dependent or independent.
asked 29 minutes ago -
python
Define a function called print_values which takes a dictionary
object as a parameter. The function...
asked 1 hour ago -
In Chapter 1 you created a program named Triangle in
which you displayed a seven-line triangle...
asked 1 hour ago -
Research question: What are the differences between separately
stated and non separately stated transactions in an...
asked 1 hour ago -
By using Arduino write a code that connects two LEDs to two
push-buttons. Each button controls...
asked 2 hours ago -
Bank of America has bonds that pay a coupon interest rate of 5.5
percent and mature...
asked 3 hours ago -
Problem: Patient Fees C++
You are to write a program that computes a patient’s bill for...
asked 5 hours ago -
In a population of interest, we know that, 77% drink coffee, and
23% drink tea. Assume...
asked 5 hours ago -
Given that f(x) = e-(x-1) for x > 1, determine the following
probabilities:
a) P(X <...
asked 5 hours ago