write the amino acid sequence of your protein. Indicate the start and stop sites
write the amino acid sequence of your protein. Indicate the start and stop sites
Homework Answers
Answer : Start site Stop site
Codon : 5' AUG GCU AGA AAU GAU UGU CAA GAA GGU CAU AUU GUU UAG 3'
Amino terminal : Methionine - alanine-arginine-asparagine -aspartic acid - cysteine - glutamine -glutamic acid -glycine - histidine -isoleucine - valine - STOP CODON Carboxy terminal
Amino acid sequence :
Add Answer to:
write the amino acid sequence of your protein. Indicate the
start and stop sites
Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the...
Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon. 5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’
Find the two other segments of the sequence among your classmates that will complete the protein....
Find the two other segments of the sequence among your classmates that will complete the protein. For example if you have a middle segment you will need to find a beginning and an end segment. Write the entire linear order of amino acids in Part 2, Question l in your proforma, (using the single letter amino acid abbreviation). Start with the beginning segment, followed by the middle segment and lastly, the end segment. Indicate the amino (NH2) and carboxyl (COOH)...
Question 6 Using the provided Genetic Code, determine the amino acid sequence of a protein when...
Question 6 Using the provided Genetic Code, determine the amino acid sequence of a protein when the mRNA is AUGAUUGACUGA. Tyrosine – threonine – valine – glutamic acid Methionine - STOP Methionine – isoleucine – aspartic acid – STOP Lysine – arginine – glycine - STOP
20. Given the following DNA sequence, write the complementary RNA sequence then the amino acid sequence...
20. Given the following DNA sequence, write the complementary RNA sequence then the amino acid sequence (hint: use the genetic code to translate from mRNA to protein!) DNA sequence: 3’- TACA A AGGUCTCCITAUGATC-5° mRNA: amino acid:
1. How can protein folding affect protein function? 2. How can amino acid sequence affect protein...
1. How can protein folding affect protein function? 2. How can amino acid sequence affect protein function? 3. How can an amino acid sequence (primary sequence) dictate 3D protein structure?
A specific stretch of DNA that programs the amino acid sequence of a protein is a...
A specific stretch of DNA that programs the amino acid sequence of a protein is a A. nucleic acid B. protein C. gene D. enzyme
QU. 5. You have identified the complete amino acid sequence on protein sequencing techniques. "Y" is...
QU. 5. You have identified the complete amino acid sequence on protein sequencing techniques. "Y" is composed of 44 amino acids with the po below. No information is available about its genetic sequence. Your task sequence for protein "Y". Assume that the gene sequence is unique in the human 5 BRIEFLY EXPLAIN methodically and accurately how you will decipher the gene seg "Y". (3 POINTS). no acid sequence of a human protein called "Y" using 1.44 amino acids with the...
Table 1: Partial RPE65 protein sequence (amino acids 41-60) for the 9-year-old LCA patient. Unmutated Protein...
Table 1: Partial RPE65 protein sequence (amino acids 41-60) for the 9-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Ser-Leu-Leu-Arg-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP Table 2. Partial RPE65 protein sequence (amino acids 61-70 and 291–300) for the 11-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-Tyr-Lys-Phe...lle-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-STOP Source: Data from Russell et al. (2017). Use Tables 1 and 2 to...
The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein...
The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein and includes the start (initiator) codon, a small amount of 5' UTR, and a small amount of 3' UTR. TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA The bottom strand is the template, and the RNA polymerase moves along the bottom (template) strand from RIGHT TO LEFT. a) Determine the orientation of the DNA template. The template strand is copied below. (Enter either 5' or 3' in the box below,...
Table 1: Partial RPE65 protein sequence (amino acids 41-60) for the 9-year-old LCA patient. Unmutated Protein...
Table 1: Partial RPE65 protein sequence (amino acids 41-60) for the 9-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Ser-Leu-Leu-Arg-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP Table 2. Partial RPE65 protein sequence (amino acids 61-70 and 291-300) for the 11-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-In-Ala-Leu-Leu-Tyr-Lys-Phe...Ile-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-STOP Source: Data from Russell et al. (2017). Use Tables 1 and 2 to...
Find the two other segments of the sequence among your classmates that will complete the protein. For example if you have a middle segment you will need to find a beginning and an end segment. Write the entire linear order of amino acids in Part 2, Question l in your proforma, (using the single letter amino acid abbreviation). Start with the beginning segment, followed by the middle segment and lastly, the end segment. Indicate the amino (NH2) and carboxyl (COOH)...
20. Given the following DNA sequence, write the complementary RNA sequence then the amino acid sequence (hint: use the genetic code to translate from mRNA to protein!) DNA sequence: 3’- TACA A AGGUCTCCITAUGATC-5° mRNA: amino acid:
QU. 5. You have identified the complete amino acid sequence on protein sequencing techniques. "Y" is composed of 44 amino acids with the po below. No information is available about its genetic sequence. Your task sequence for protein "Y". Assume that the gene sequence is unique in the human 5 BRIEFLY EXPLAIN methodically and accurately how you will decipher the gene seg "Y". (3 POINTS). no acid sequence of a human protein called "Y" using 1.44 amino acids with the...
Table 1: Partial RPE65 protein sequence (amino acids 41-60) for the 9-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Ser-Leu-Leu-Arg-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP Table 2. Partial RPE65 protein sequence (amino acids 61-70 and 291–300) for the 11-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-Tyr-Lys-Phe...lle-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-STOP Source: Data from Russell et al. (2017). Use Tables 1 and 2 to...
The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein and includes the start (initiator) codon, a small amount of 5' UTR, and a small amount of 3' UTR. TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA The bottom strand is the template, and the RNA polymerase moves along the bottom (template) strand from RIGHT TO LEFT. a) Determine the orientation of the DNA template. The template strand is copied below. (Enter either 5' or 3' in the box below,...
Table 1: Partial RPE65 protein sequence (amino acids 41-60) for the 9-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Ser-Leu-Leu-Arg-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP Table 2. Partial RPE65 protein sequence (amino acids 61-70 and 291-300) for the 11-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-In-Ala-Leu-Leu-Tyr-Lys-Phe...Ile-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-STOP Source: Data from Russell et al. (2017). Use Tables 1 and 2 to...
Most questions answered within 3 hours.
-
3. Gains from trade
Consider two neighbouring island countries called Euphoria and
Contente. They each have...
asked 11 minutes ago -
A business executive has the option to invest money in two
plans: Plan A guarantees that...
asked 2 hours ago -
Hello, can someone please help me answer this question?
How much heat is absorbed by a...
asked 2 hours ago -
. A marketing researcher conducted a survey of 25 shoppers
randomly selected at the local mall...
asked 2 hours ago -
Create an comprehensive response to the
following:
Antimicrobial agents work on a multitude of microbes (bacteria,...
asked 2 hours ago -
6.13 LAB: Step counter. Section 6.3.
A pedometer treats walking 2,000 steps as walking 1 mile....
asked 2 hours ago -
(14.2) A block of mass m = 10 kg riding on a frictionless
horizontal plane is...
asked 2 hours ago -
Use any search engine to search for articles about Starbucks
partnership with Tata Companies in India...
asked 2 hours ago -
Let’s say that for some reason Bank Excess Reserves suddenly
increase sharply. What effect would this...
asked 2 hours ago -
Given:
Curent Assets: $600,000
Total Assets: $2,600,000
Current Liabilities: $500,000
Total Liabilities: $1,700,000
What is the...
asked 2 hours ago -
1. What is a “Bankster”? What is insider trading? Why is it
illegal?
2. What is...
asked 2 hours ago -
A transverse wave on a cord is given by
D(x,t)=0.18sin(2.7x−61.0t), where Dand x are in m...
asked 3 hours ago