Homework Answers
Answer d. histone/nucleosome
DNA wraps around a histone octamer resulting in a structure called a nucleosome.
The histones are responsible for the packing of atleast 2 meters of DNA into a nucleus, that is about 5µm in diameter. DNA helix wraps around a core of eight histone molecules (two copies of each of H2A, H2B, H3 and H4), giving the appearance of a string of beads, which are known as a histone octamer. Each bead is called a nucleosome.
Add Answer to:
5. DNA wraps around a octamer resulting in a structure called a a. bead / chromosome...
Which does not describe eukaryotic histones in a nucleosome structure? A. A core histone plus a...
Which does not describe eukaryotic histones in a nucleosome structure? A. A core histone plus a linker histone octamer B. A core histone octamer plus a linker histone C. A core histone octamer plus 2 linker histones D. A core histone nonamer E. A core histone heptamer plus a linker histone
Which of the following is the core of histones that DNA wraps around? A) 2H2A B)...
Which of the following is the core of histones that DNA wraps around? A) 2H2A B) 2H2B C) 2H3 D) 2H4 E) these all makeup of the core histones
Which of the following is not part of a human chromosome in any phase? A. centromere...
Which of the following is not part of a human chromosome in any phase? A. centromere B. euchromatin C. nucleosome D. histone E. centriole
Eplgenetic modifications to DNA sequences end resulting alterations in chromatin structure can be analyzed by examining...
Eplgenetic modifications to DNA sequences end resulting alterations in chromatin structure can be analyzed by examining DNA methylation and histone modifications. To examine methylation of a DNA sequence, you treat It with sodium bisulfite. If your original DNA sequence Is: ACAGTCCGTCGGAGCCTGCCAGTCGATCGCACCT and yum sequence after trearment reads ACAGTTCGTCGGAGCTTCTTAGTOSATCGCACTT. Which positions on the original DNA sequence are methylated? (Indicate methylations with an * after the affected nucleotide) b.) When this DNA sequence is replicated, which of these methylations will be transferred...
Fill in the blank: During chromosome replication, the _________ enzyme synthesizes short RNA primers that get...
Fill in the blank: During chromosome replication, the _________ enzyme synthesizes short RNA primers that get extended to form the ___________ fragments. This process uses the __________ strand as the template. Type II topoisomerases such as DNA gyrase change the LINKING number of DNA in increments of ____. They use a _________ amino-acid side chain at the active site to form a ___________ linkage to the broken DNA strands. The protein core of a nucleosome consists of ___ copies each...
QUESTION 1 A nucleosome consists of A. a cluster of histone proteins that are wrapped around...
QUESTION 1 A nucleosome consists of A. a cluster of histone proteins that are wrapped around the DNA double helix. B. two peptides each of histones H2A, H2B, H3 and H4, wrapped by the DNA double helix. the DNA polymerase complex and the Okazaki fragments of approximately 200 bases in C. length. D. clusters of ribosomal large subunits and small subunits bound to the DNA double helix. E. one of each of the 5 types (H1 - H4) of histone...
The change in the chromosomes depleted between the top and the bottom in the figure above...
The change in the chromosomes depleted between the top and the bottom in the figure above represents a(n). A) inversion B) duplication C) reciprocal translational D) deletion E) None of these are correct In a DNA nucleotide. any of four nitrogenous bases would be found attached to A) carbon #1 of the sugar molecule. B) carton #2 of the sugar molecule C) carbon #3 of the sugar molecule. D) carbon of the sugar molecule E) carbon #5 of the sugar...
Alterations of chromatin of DNA structure that are stable and inheritable in offspring via DNA methylation...
Alterations of chromatin of DNA structure that are stable and inheritable in offspring via DNA methylation or alteration of histone proteins is referred to as _____ changes. A. epigenetic B. sensitivity C. mutational D. genetic
In eukaryotes, genomic DNA is wrapped around the histone complex to make chromatin. The direct contacts...
In eukaryotes, genomic DNA is wrapped around the histone complex to make chromatin. The direct contacts between DNA and the histone beads interfere bindings of the transcriptional factor proteins to their cognate sequence elements, decreasing gene activities. To increase transcriptional activity of the affected genes, the RSC/CRC complex remodels chromatins such that the ________ sequences can be amenable to formation of the transcriptional initiation complex. Select one: a. TBP-binding and TAP-binding b. Shine-Dalgarno c. start codons d. All of these...
Question 34 Chromosomes can be visualized with fluorescent DNA probes, which complementary bind to chromosomes. What...
Question 34 Chromosomes can be visualized with fluorescent DNA probes, which complementary bind to chromosomes. What is the name of this technique? ADNA fingerprinting BDNA in-situ hybridization (FISH) Sanger sequencing Polymerase chain reaction (PCR) Northern blot Question 35 The cell most often communicates 'opening and closing of the DNA structure via: A methylation on the DNA backbone B. phosphorylation or methylation of mRNA molecules c covalent modifications of histone tails D. 5' capping of genes on DNA E. all of...
Eplgenetic modifications to DNA sequences end resulting alterations in chromatin structure can be analyzed by examining DNA methylation and histone modifications. To examine methylation of a DNA sequence, you treat It with sodium bisulfite. If your original DNA sequence Is: ACAGTCCGTCGGAGCCTGCCAGTCGATCGCACCT and yum sequence after trearment reads ACAGTTCGTCGGAGCTTCTTAGTOSATCGCACTT. Which positions on the original DNA sequence are methylated? (Indicate methylations with an * after the affected nucleotide) b.) When this DNA sequence is replicated, which of these methylations will be transferred...
QUESTION 1 A nucleosome consists of A. a cluster of histone proteins that are wrapped around the DNA double helix. B. two peptides each of histones H2A, H2B, H3 and H4, wrapped by the DNA double helix. the DNA polymerase complex and the Okazaki fragments of approximately 200 bases in C. length. D. clusters of ribosomal large subunits and small subunits bound to the DNA double helix. E. one of each of the 5 types (H1 - H4) of histone...
The change in the chromosomes depleted between the top and the bottom in the figure above represents a(n). A) inversion B) duplication C) reciprocal translational D) deletion E) None of these are correct In a DNA nucleotide. any of four nitrogenous bases would be found attached to A) carbon #1 of the sugar molecule. B) carton #2 of the sugar molecule C) carbon #3 of the sugar molecule. D) carbon of the sugar molecule E) carbon #5 of the sugar...
Question 34 Chromosomes can be visualized with fluorescent DNA probes, which complementary bind to chromosomes. What is the name of this technique? ADNA fingerprinting BDNA in-situ hybridization (FISH) Sanger sequencing Polymerase chain reaction (PCR) Northern blot Question 35 The cell most often communicates 'opening and closing of the DNA structure via: A methylation on the DNA backbone B. phosphorylation or methylation of mRNA molecules c covalent modifications of histone tails D. 5' capping of genes on DNA E. all of...
Most questions answered within 3 hours.
-
1. An object weighing 40 N rests on a surface. The coefficient
of friction is 0.35....
asked 14 minutes ago -
Investor company owns 35% of investee company voting stock and
accounts for the investment under the...
asked 1 hour ago -
The number of major faults on a randomly chosen 1 km stretch of
highway has a...
asked 1 hour ago -
Consider the competitive environment of Starbuck's, Progressive
Insurance, a manufacturing firm with low turnover, or a...
asked 2 hours ago -
3. Gains from trade
Consider two neighbouring island countries called Euphoria and
Contente. They each have...
asked 4 hours ago -
A business executive has the option to invest money in two
plans: Plan A guarantees that...
asked 6 hours ago -
Hello, can someone please help me answer this question?
How much heat is absorbed by a...
asked 6 hours ago -
. A marketing researcher conducted a survey of 25 shoppers
randomly selected at the local mall...
asked 6 hours ago -
Create an comprehensive response to the
following:
Antimicrobial agents work on a multitude of microbes (bacteria,...
asked 6 hours ago -
6.13 LAB: Step counter. Section 6.3.
A pedometer treats walking 2,000 steps as walking 1 mile....
asked 6 hours ago -
(14.2) A block of mass m = 10 kg riding on a frictionless
horizontal plane is...
asked 6 hours ago -
Use any search engine to search for articles about Starbucks
partnership with Tata Companies in India...
asked 6 hours ago