The sequence of part of an mRNA transcript is 5' – AUGAGCAACAGCAAGAGUGCGGCACUGUCCACAGAG - 3' What is...

Question

Question

The sequence of part of an mRNA transcript is 5 – AUGAGCAACAGCAAGAGUGCGGCACUGUCCACAGAG - 3 What is the sequence of the DNA

Answer 1

Answer #1

Ans) The sequence of a part of mRNA transcript is given as follows :

5' AUGAGCAACAGCAAGAGUGCGGCACUGUCCACAGAG 3'

The sequence of the DNA template strand will be

3' TACTCGTTGTCGTTCTCACGCCGTGACAGGTGTCTC 5' Or 5' CTCTGTGGACAGTGCCGCACTCTTGCTGTTGCTCAT 3'

If the 3' to 5' sequence of the DNA template strand is

3' TACTCGTTGTCGTTCTCACGCCGTGACAGGTGTCTC 5' , then the 5' to 3' sequence of DNA coding strand will be complementary to it.

The 5' to 3' sequence of DNA coding strand is,

5' ATGAGCAACAGCAAGAGTGCGGCACTGTCCACAGAG 3'.

Answer 2

Similar Homework Help Questions

mRNA Transcript and Features: 4 In sequence (b) below, use your mouse to click and mark...

mRNA Transcript and Features: 4 In sequence (b) below, use your mouse to click and mark the mid-point of the Shine-Dalgarno sequence. Shown below are: (a) the 5' sequence of an mRNA transcript of an E. coli gene, and (b) the DNA coding strand with the sequence of the promoter and beginning of the coding sequence of the gene. (a) ACAUCCUAGGAGGAUUACCCAUGCGGU... (b) ...GGCTTGACATACCGATGGTTCAA CTGGATATAATGTAGCTCACATCCTAGGAGGATTACCCATGCGGTCC...
You have the following mRNA sequence: 5’-GCAUGAUAUGCGAGCUAHCAUGACGU-3’ What is the DNA coding strand, template strand, and...

You have the following mRNA sequence: 5’-GCAUGAUAUGCGAGCUAHCAUGACGU-3’ What is the DNA coding strand, template strand, and tRNA sequence. Where is the start and stop codons and provide the resultant polypeptide sequence
Below is the mRNA sequence for the mRNA transcript used as the blueprint to make a...

Below is the mRNA sequence for the mRNA transcript used as the blueprint to make a specific protein. Write the DNA leading strain sequence, complimentary lagging stain sequence, and the protein with the amino acid sequence. Use the Codon Table provided. The mRNA transcript is provided for you. Leading strain : 5’ Lagging strain: 3’ mRNA transcript:5’ AUG UAC UAG GGC CCA AUU GAA ACG GGG ACC CCA GCC UGA3’ protein amino acid:

1.A The mRNA sequence below is the full length of the mature mRNA transcript. On the...

1.A The mRNA sequence below is the full length of the mature mRNA transcript. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. This transcript arrives at a ribosome. Determine the anticodon sequence for the first three tRNA used to make the polypeptide. Label the 5’and 3’ends on the tRNAs. 5' AAUCGAUGUAAUCCGCAUC 3' B. Hydrolysis reactions They do so by link monomers to form a polymer; adding a water molecule remove monomers from...
If the sequence of an mRNA molecule is: 5' AUG CGA GUU CCG 3' a) Give...

If the sequence of an mRNA molecule is: 5' AUG CGA GUU CCG 3' a) Give the sequence of the template strand of DNA. (Please indicate where the 5' and 3' ends are located) b) Give the sequence of the non-template strand of DNA. (Please indicate where the 5' and 3' ends are located) c) Give the amino acid sequence.
DNA sequence of a one strand of a gene to be transcribed is: 3’ — AGTCCGATGGGCT...

DNA sequence of a one strand of a gene to be transcribed is: 3’ — AGTCCGATGGGCT GA — 5’ the sequence of the MRNA is: 3’ — AGUCCGAUGGGCTGA — 5’ the sequence of the DNA strand shown above is that of the: a. template strand b. coding strand

If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give...

If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give the sequence of the template strand of DNA. (Please indicate where the 5' and 3' ends are located) (1.5 marks) (b) Give the sequence of the non-template strand of DNA. (Please indicate where the 5' and 3' ends are located) (1.5 marks) (c) Give the amino acid sequence. (1.5 marks)
1) The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... What is the nucleotide sequence of...

1) The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... What is the nucleotide sequence of the DNA template strand from which it was transcribed? 2) If this mRNA is translated beginning with the first AUG codon in its sequence, what is the N-terminal amino acid sequence of the protein that it encodes?
3. Now consider the sequence that results for a different mutant protein. Using the DNA coding...

3. Now consider the sequence that results for a different mutant protein. Using the DNA coding strand sequence provided, predict the sequences of the DNA template strand, mRNA, and polypeptide for the mutant gene. DNA coding strand for mutant gene 2: S'ACTGCCCLATGGTGTAG CTG ACTCCTGAGGAG13 On the line above, write the sequence for the template DNA strand, On the line below, write the sequence for the mRNA for mutant protein: On the line below, write the sequence for the Polypeptide for...

what base in mRna transcript would represent the DNA templete sequence ?

what base in mRna transcript would represent the DNA templete sequence ?