Homework Answers
Retrovirus such as HIV have two copies of single-stranded RNA.
HIV is a retrovirus, with two single stranded RNA as its genome enclosed within capsid core. Inside the capsid core are also present nucleocapsid and other essential viral proteins. Envelope of HaiV is glycoproteinaceous in nature.
Add Answer to:
Retroviruses such as HIV have o two copies of single-stranded DNA o one copy of single-stranded...
Viruses are composed of O proteins, RNA and ribosomes O single stranded DNA O double stranded...
Viruses are composed of O proteins, RNA and ribosomes O single stranded DNA O double stranded DNA and RNA Single stranded RNA O RNA or DNA, but never both, and a protein coat
Which protein binds to single-stranded DNA, allowing the single-stranded DNA to invade a double-stranded DNA double...
Which protein binds to single-stranded DNA, allowing the single-stranded DNA to invade a double-stranded DNA double helix with sequence homology? O A. RecA OB. RecB OC. Single-stranded DNA binding protein OD. Recc O E. RecD
Retroviruses use the enzyme reverse transcriptase to Retroviruses use the enzyme reverse transcriptase to synthesize a...
Retroviruses use the enzyme reverse transcriptase to Retroviruses use the enzyme reverse transcriptase to synthesize a hybrid molecule with one DNA stranded base-paired to the complementary RNA strand. synthesize double-stranded RNA. direct the production of DNA from a single-stranded RNA genome. transcribe mRNA from a DNA genome. synthesize sense-stranded mRNA from an antisense RNA genome.
The process of DNA replication yields two identical DNA molecules from a single double-stranded molecule. Cellular...
The process of DNA replication yields two identical DNA molecules from a single double-stranded molecule. Cellular proof-reading and error-checking mechanisms ensure nearly perfect fidelity of the DNA copies. However, RNA viruses lack replication error-checking mechanisms, and thus have higher rates of genetic variation. Discuss the importance of error-checking mechanisms during replication and how in the absence of these mechanisms genetic variation is introduced.
The process of DNA replication yields two identical DNA molecules from a single double-stranded molecule. Cellular proof-reading and error-checking mechanisms ensure nearly perfect fidelity of the DNA...
The process of DNA replication yields two identical DNA molecules from a single double-stranded molecule. Cellular proof-reading and error-checking mechanisms ensure nearly perfect fidelity of the DNA copies. However, RNA viruses lack replication error-checking mechanisms, and thus have higher rates of genetic variation. Discuss the importance of error-checking mechanisms during replication and how in the absence of these mechanisms genetic variation is introduced.
QUESTION 9 Strand invasion requires a__, O A. 5', single-stranded B. 5', double-stranded ° C. 3, single-stranded O D.3', double-stranded DNA molecule. QUESTION 10 The form of genetic reco...
QUESTION 9 Strand invasion requires a__, O A. 5', single-stranded B. 5', double-stranded ° C. 3, single-stranded O D.3', double-stranded DNA molecule. QUESTION 10 The form of genetic recombination that allows movement of genetic elements from one DNA site to another is termed: O A site-specific recombination O B. homologous recombination ° C. branch migration D.transposition
QUESTION 9 Strand invasion requires a__, O A. 5', single-stranded B. 5', double-stranded ° C. 3, single-stranded O D.3', double-stranded DNA molecule. QUESTION 10...
This genetic material can be directly translated into protein a. DNA b. Negative-sense single stranded RNA...
This genetic material can be directly translated into protein a. DNA b. Negative-sense single stranded RNA c. Positive-sense single stranded RNA d. Amino acids
In a test tube, a strand of double-stranded DNA can be separated into two single-stranded DNA...
In a test tube, a strand of double-stranded DNA can be separated into two single-stranded DNA molecules by applying energy such as heat. Sequences for two different dsDNA molecules are shown below (dsDNA 1 and dsDNA 2). Which one of these two would require less energy to be separated? Explain your reason. Note: Both dsDNA are 20 base pairs long. The sequence for only one of the strands in each dsDNA are shown dsDNA 1: GCGCACGGACGGCCCGCACC dsDNA 2: TATTAGTATACTAATAAGTT
The activity of would be quickly undone in the absence of single-stranded binding protein. O DNA...
The activity of would be quickly undone in the absence of single-stranded binding protein. O DNA polymerase | O DNA polymerase III O DNA ligase O DNA helicase O primase
In RNA interference studies, the double-stranded RNA Select one: a. disrupts the target DNA sequence b....
In RNA interference studies, the double-stranded RNA Select one: a. disrupts the target DNA sequence b. results in the destruction of the target mRNA c. destroys the target protein d. all of the above Hint: it's not D
Viruses are composed of O proteins, RNA and ribosomes O single stranded DNA O double stranded DNA and RNA Single stranded RNA O RNA or DNA, but never both, and a protein coat
Which protein binds to single-stranded DNA, allowing the single-stranded DNA to invade a double-stranded DNA double helix with sequence homology? O A. RecA OB. RecB OC. Single-stranded DNA binding protein OD. Recc O E. RecD
QUESTION 9 Strand invasion requires a__, O A. 5', single-stranded B. 5', double-stranded ° C. 3, single-stranded O D.3', double-stranded DNA molecule. QUESTION 10 The form of genetic recombination that allows movement of genetic elements from one DNA site to another is termed: O A site-specific recombination O B. homologous recombination ° C. branch migration D.transposition
QUESTION 9 Strand invasion requires a__, O A. 5', single-stranded B. 5', double-stranded ° C. 3, single-stranded O D.3', double-stranded DNA molecule. QUESTION 10...
In a test tube, a strand of double-stranded DNA can be separated into two single-stranded DNA molecules by applying energy such as heat. Sequences for two different dsDNA molecules are shown below (dsDNA 1 and dsDNA 2). Which one of these two would require less energy to be separated? Explain your reason. Note: Both dsDNA are 20 base pairs long. The sequence for only one of the strands in each dsDNA are shown dsDNA 1: GCGCACGGACGGCCCGCACC dsDNA 2: TATTAGTATACTAATAAGTT
The activity of would be quickly undone in the absence of single-stranded binding protein. O DNA polymerase | O DNA polymerase III O DNA ligase O DNA helicase O primase
Most questions answered within 3 hours.
-
When finding confidence interval for mu , if population standard
deviation (sigma) is known, we use...
asked 29 minutes ago -
Convert your enthalpy of reaction (kJ/mol) to heat of explosion
(kJ/kg) using the molar mass of...
asked 14 minutes ago -
At what annual rate would the following have to be
invested?
$8,929, to grow to $55,581,...
asked 13 minutes ago -
If the codon were 5 bases long instead of three, how many codons
would exist in...
asked 20 minutes ago -
Mittuch Corp. is evaluating a project with the following cash
flows. The company uses a discount...
asked 27 minutes ago -
An income elasticity coefficient of −1.8 means the product is a
normal good.
true or false
asked 20 minutes ago -
PLEASE ANSWER ASAP ASIAN AMERICAN HISTORY
Considering the number of migrants and the time period in...
asked 27 minutes ago -
1. If a good has a price elasticity of demand equal to
0, ________.
a) the...
asked 30 minutes ago -
1. Research through the literature give other ways of converting
methyl benzenes to benzoic acids, draw...
asked 32 minutes ago -
a) A car has a fuel economy of 25 miles per gallon. Calculate
this value in...
asked 43 minutes ago -
Q1- say a letter in a word is missing, can you find the missing
letter? For...
asked 51 minutes ago -
What is the temperature of 100.0 grams of chlorine gas in a
55.0-L container at 800....
asked 1 hour ago