ZuoTi.Pro
Question

In RNA interference studies, the double-stranded RNA Select one: a. disrupts the target DNA sequence b....

In RNA interference studies, the double-stranded RNA

Select one:

a. disrupts the target DNA sequence

b. results in the destruction of the target mRNA

c. destroys the target protein

d.

all of the above

Hint: it's not D

science   biology   
0 0
Add a comment Improve this question Transcribed image text
Next > < Previous
Sort answers by oldest

Homework Answers

Answer #1

b. results in the destruction of the target mRNA.

The sequence of events is as follows:

1. The double stranded RNA is broken down into short RNAs.

2. These short RNA activate ribonuclease.

3. These ribonuclease then target homologous mRNA and degrade them.

0 0
Add a comment
Know the answer?
Add Answer to:
In RNA interference studies, the double-stranded RNA Select one: a. disrupts the target DNA sequence b....
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions

  • i) Given the mRNA sequence UCAGAUCCU, write the double-stranded DNA sequence that would have produced this...

    i) Given the mRNA sequence UCAGAUCCU, write the double-stranded DNA sequence that would have produced this m-RNA sequence. ii) Indicate which strand of DNA is actually used as a template for the synthesis of the mRNA. iii) Show the amino acid sequence that would be expected from this mRNA.

  • Part A Outline the roles of double-stranded RNA (dsRNA) in eukaryotic gene regulation. Select all that...

    Part A Outline the roles of double-stranded RNA (dsRNA) in eukaryotic gene regulation. Select all that apply. Part A Outline the roles of double-stranded RNA (dsRNA) in eukaryotic gene regulation Select all that apply. O dsRNA can inhibit gene expression by inhibition of transcription through heterochromatin formation. O dsRNA can inhibit gene expression by inhibition of transcription through inhibitor synthesis. O dsRNA can inhibit gene expression by destruction of mRNA. O dsRNA can inhibit gene expression by inhibition of replication....

  • Why is transcription referred to ”DNA-Directed RNA synthesis”? A. The RNA sequence directs the synthesis of...

    Why is transcription referred to ”DNA-Directed RNA synthesis”? A. The RNA sequence directs the synthesis of the template DNA strand. B. The sequence of the RNA strand is transferred to the DNA. C. RNA is synthesized using a template DNA strand. D. A double stranded RNA is synthesized using a single stranded RNA.

  • The following double stranded segment of DNA is part of a protein coding gene. The segments...

    The following double stranded segment of DNA is part of a protein coding gene. The segments in uppercase letters (ACTG) represent the exons. The segments in lowercase letters (acgt) represent introns. The lower strand is the template strand that is used by the RNA polymerase to make an RNA transcript. GCTAAATGGCAaaattgccggatgacGCACATTGACTCG Gaatcga GGTCAGATGC CGATTTACCGTtttaacggcctact CGTGTA ACTGAGCCttagctCCAGTCTACG write-out: The sequence of the primary transcript: The mature mRNA resulting from this stretch of DNA:

  • In the first stage of RNA interference, a __________ RNA precursor is cleaved by the _________...

    In the first stage of RNA interference, a __________ RNA precursor is cleaved by the _________ enzyme. The cleaved molecules are approximately _________ (insert number) bases in length and are called ___RNA if the RNA originated from a virus or ___RNA if the RNA was of endogenous origin ( if the RNA precursor was produced artificially, it's called ___RNA. The cleaved RNA is then separated into _____________ RNA, which then binds to the ribonuclease complex called __________. The short RNA...

  • Only one strand of a double stranded DNA fragment is shown below. This DNA encodes a...

    Only one strand of a double stranded DNA fragment is shown below. This DNA encodes a beginning of a polypeptide. GTGATGCGGCGCGCGCCACCACATGTGAAAAAATAACTCCGGCATTACGAACCTCGAAGAATCGGGATTTAGCCATTATAGCTAGCC 1. Write down the sequence of mRNA which will be transcribed from this DNA. Hint: it is impossible to identify the first base of a mRNA accurately from just sequence analysis, therefore, chose the first base within plus-minus 2 bp from a real start. (10 points) ABC 2. Write the N-terminal portion of polypeptide which is encoded by this...

  • .Select the probe sequence that will hybridize to the following nucleic acid sequence: C G A...

    .Select the probe sequence that will hybridize to the following nucleic acid sequence: C G A T A T T G T C A. T A G T A C A A G A B. C G A T A T T G T C C. G T C A A G A C C T D G C T A T A A C A G Select the strand of RNA that is complementary to this single strand of...

  • The partial sequence of one strand of a double stranded DNA molecule is: 5’ ---GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG--- 3’...

    The partial sequence of one strand of a double stranded DNA molecule is: 5’ ---GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG--- 3’ Write the sequence of both strands of the DNA fragment when this DNA is cleaved with both EcoRI and PstI. The top of your duplex DNA fragment should be derived from the standard sequence given above.

  • using the codon table, write mRNA and DNA (double stranded) sequence for the peptide below (assume...

    using the codon table, write mRNA and DNA (double stranded) sequence for the peptide below (assume a stop codon is present and include it). Several correct sequences are possible due to the degeneracy of the genetic code; write only one sequence for each question. Remember to properly label ends. H2N - Methionine - Aspartate - Lysine - Serine - Valine - Leucine - COOH mRNA: DNA:

  • A segment of a double-stranded DNA molecule is shown below. The start of a gene is...

    A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT