The complement of base G (Guanine) is C (Cytosine) and viceversa.
The complement of base A (Adenine) is T (Thymine) and viceversa
Thus
G--->C
T--->A
C--->G
A--->T
Thus the answer is 3'-CAGGTC 5"
One of the stands of a piece of DNA has the sequence GTCCAG 3. What is...
If the sequence of one strand of DNA is 5' ATGCAGGCTGATCCGACGAAG 3', what is the sequence of the complementary stand?
If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the following sequence o 3-AATGCTAC-5' 3'-CATCGTAA-5 3-GTAGCATT-5 3-TTACGATG-5 Question 2 20 pts Which of the following does the enzyme primase make? phosphodiester linkages (bonds) Okazaki fragments RNA primer DNA primer In which direction does DNA replication take place? 3'to 5 5'to 5 5'to 3 3'to 3 Question 4 20 pts Which enzyme unwinds the double-stranded helical DNA starting at the origin of replication? ligase primase...
Canvas Question 26 (Short answer) One strand of a double-helical DNA has the sequence (5')GCGCAATATTCTCAAAATAT(3"). A) Write the base sequence of the complementary strand. B) Explain what complementary means in nucleic acid chemistry BIVA-A I E III XX, E - 2 x C1 12pt Paragraph O words 31
What is the complementary sequence to the DNA strand 5' TGACGTGAT 3'? Enter the sequence in the 3' to 5' direction.
If one strand of DNA has the sequence C-T-A-C-C-G-T-T-A, what sequence would appear opposite it on the other strand? Enter the complementary sequence of letters separated by hyphens.
Question 15 2 pts Given the DNA sequence 3 GTACG5' what is the sequence of the complementary strand? Include the directionality! (the 3' and 5 on the ends so I know which direction the strand is going)
Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5' and 3' ends) for each mutated DNA sequence, then transcribe (indicating 5' and 3' ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid...
3. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’ - T A C T G A C T G A C G A T C - 5’. Each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. a. Construct the complementary DNA sequences (indicating 5’ and 3’ ends) for each mutated DNA sequence. b. Transcribe (indicating 5’ and 3’ ends) the...
QUESTION 34 The nucleotide sequence of one DNA strand of a DNA double helix is 5-GGATTTTTGTCCACAATCA-3' What is the sequence of the complementary strand? A. 5-CCTAAAAACAGGTGTTAGT-3 B.3.CCUAAAAACAGGUGUUAGU-5 C.3-CCTAAAAACAGGTGTTAGT-5 D. None of these QUESTION 35 In the DNA of the spinach chloroplast, 31% of the nitrogenous bases are adenine (A). What are the percentages of the other bases? A. 25% G, 25% C, 19% T B. 19% G, 19% C, 31% T C.31% G, 19% C, 19% T D.31% G, 31%...
1. What is the nucleotide sequence of the DNA strand that is complementary to 5-ATCGCAACTGTCACTA-3'?