1. The type of mutation shown in (a) is substitution
2. The type of mutation shown in (b) is substitution
3. The type of mutation shown in (c) is substitution
4. The type of mutation shown in (d) is insertion
Question 37 1 pts Identify each type of mutation shown here. Wild-type DNA DNA template strand...
Label each of the four mutated DNA segments (a-d) below according to the type of mutation each represents. Use the codon chart to determine how each mutation would impact the amino acid for each segment. Wild-type DNA DNA template strand 3' TACGCAGGTACCATC5 S' ATGCGTCCATGCTAG 3' MANA 5 AUGCGUCCAUGCUAC 3 protein MA Pret - instead of DA 3* TAccccccTACCATc s' ONA 3' TACGCAGGTACTATC 5 5' ATGCGGCCATGCTAG 3 5' ATGCGTCCATGATAG 3 mRNA 5' AUGCGGCCAUGCUAG 3 mRNAS AUGCGUCCAUGAUAG 3' ol -Extrac A instead...
3. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’ - T A C T G A C T G A C G A T C - 5’. Each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. a. Construct the complementary DNA sequences (indicating 5’ and 3’ ends) for each mutated DNA sequence. b. Transcribe (indicating 5’ and 3’ ends) the...
1. The template DNA strand of the MCB gene is shown below: 5’ ACAGGAGAGTGGAAACATG 3’ What is the sequence of the mRNA produced from this? A) 3’ TGTCCTCTCACCTTTGUAC 5’ B) 3’ UGUCCUCUCACCUUUGUAC 5’ C) 5’ ACAGGAGAGUGGAAACAUG 3’ D) 5’ UGUCCUCUCACCUUUGUAC 3’ E) 3’ ACAGGAGAGUGGAAACAUG 5’ 2. The template DNA strand of the MCB gene is shown below: 5’ ACAGGAGAGTGGAAACATG 3’ What is the amino acid sequence that the MCB gene codes for? A) MET – PHE – THR –...
Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5' and 3' ends) for each mutated DNA sequence, then transcribe (indicating 5' and 3' ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid...
can i get help with this question please
Reference Sequence Wild-Type DNA Template Sequence: mRNA Sequence: Amino Acid Sequence: TAC ACC TTG GCG ACG ACT AUG UGG AAC CGC UGC UGA Met-Top-Asn--Ars--Y-STOP NS. Mutated DNA Template Sequence #5: TAC ACC TTG GGA CGA CT Compare the mutated DNA#5 with the wild-type DNA sequence. Do you observe a substitution, deletion, or insertion mutation? The mRNA sequence derived from mutated DNA #5 is AUG UGG AAC CCU GCU GA Use Table 10.3...
Consider the most common Cystic Fibrosis variant: Wild-type CFTR DNA (Coding-strand): 3 ATC ATC TTT GGT GTT atc att ggt gtt... Cystic Fibrosis odi 1. Add the 5' and 3' designations to the DNA. 2. Write the template sequence for the DNA 3. Transcribe the wild-type and CF DNA into mRNA. Be sure to include the 5'/3' labels. 4. Translate the wild-type and CF mRNA into protein. Be sure to label these ends also. 5. In the above wild-type protein,...
2) Given the following DNA sequence, identify the template strand, transcribe the template strand, and translate the mRNA. 5' GCGATGAAACGCCCGACGTAGGGC 3' 3' CGCTACTTTGCGGGCTGCATCCCG 5'
Question 38 16 pts Question Code CDC The following sequence represents the DNA template strand of a gene, 3'-TAC CGT GTC TCC TCA GGC ATC-5' nucleotide number 1 21 a. What is the mRNA transcribed from this sequence? b. What is the amino acid sequence translated from the mRNA? c. If there is a transition at nucleotide #10, what is the amino acid sequence? R REROS d. What type of mutation is this (choose from frameshift, missense, nonsense, silent)? e....
1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2. What enzyme facilitates the complementary base pairing used to make the complementary strand in question #1. 3. At what site on the DNA molecule does transcription initiate? At what site on the DNA does transcription terminate? 4. Use the DNA molecule from question #1 and transcribe an mRNA molecule. Show the nucleotide sequence of the mRNA molecule. 5. What enzyme is responsible for transcription?...
A template strand of DNA in a gene reads 3’ CCA AGC TCT 5’.
Using the codon chart provided, answer the following
questions:
-What is the sequence of amino acids that is produced when this
gene is translated?
-If a mutation causes a substitution (an A instead of a T) 3’
CCA AGC ACT 5’, what effect will it have on the mRNA transcript AND
on the protein?
-What do we call this type of mutation?
Second letter U С...