Question 5: Use accession number “CU329670” to search the
Nucleotide database.
a. What is the type of sequence? What is the length of sequence?
What is the name of database division?
b. What is the scientific name of organism?
Go to the FEATURES section of the record. Link to the CDS to gain
access to the first 5662 nucleotides of the sequence.
c. Name the protein product of the CDS and the length of
protein.
d. Write the first four amino acids.
e. Write the nucleotide sequence of the coding strand that
corresponds to these amino acids.
f. Write the nucleotide sequence of the template strand that
corresponds to these amino acids. (Note that the definition of the
coding strand is the strand of DNA within the gene that is
identical to the transcript and the template strand is the strand
that is complementary to the coding strand.)
a. The type of a sequence is DNA sequence.The length of the sequence is 5579133bp. The name of the database is ncbi (Genbank).
b. The scientific name iof organism is Schizosaccharomyces pomb.
c. Protein product is RecQ type DNA helicase.It contains 1887 amino acids
d. The first four amino acids are methionine M ,valine V,valine V, alanine A.
e. 5'ATGGTCGTCGCT3' coding strand
f. 3'TACCAGCAGCGA5' template strand
Question 5: Use accession number “CU329670” to search the Nucleotide database. a. What is the type...
x Assignment 1 - Database.pdf ... Learn how to access and use NCBI databases Question 1: Search Taxonomy database for: 1) Homo sapiens, 2) Heterodoxus macropus, 3) E. coli. a. What is the common name of the species? b. How many nucleotide or protein sequence records do you find (show your search results in cropped windows)? Question 2: Use the name "plague thrips" to search the Nucleotide database. a. What is the scientific name of the plague thrips? b. How...
x Assignment 1 - Database.pdf ... Learn how to access and use NCBI databases Question 1: Search Taxonomy database for: 1) Homo sapiens, 2) Heterodoxus macropus, 3) E. coli. a. What is the common name of the species? b. How many nucleotide or protein sequence records do you find (show your search results in cropped windows)? Question 2: Use the name "plague thrips" to search the Nucleotide database. a. What is the scientific name of the plague thrips? b. How...
Find the human BRCA1 gene transcript mRNA using NCBI refseq database.(hint: accession NM_007299.) (a) What is the GI number of the protein? (b) What is the length of the mRNA sequence? (c) Write down the mRNA sequence as it is shown on the database. (d) Also find and write the sequence in FASTA format. (e) How many of each of the four nucleotides A, C, T and G, are there in the genome? (f) How many occurrences of the DNA...
Question 2: Transcription, RNA Processing and Translation A particular gene codes for a mature mRNA transcript containing 1200 bases, which is translated into a protein containing 300 amino acids. A. How long is the coding sequence in this mRNA and how many nucleotides are in the UTRs? For the purposes of this question we are ignoring the G’ cap and the polyA tail. B. A mutant form of the gene created by one nucleotide being changed to another nucleotide also...
DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2 Gene 1 Gene 3 DNA strand3 TRANSLATION Protein Trp Gly Model 2 ACTIVITY and QUESTIONS 1. Based on the information you can gather from model 1 complete the following sentences: a. The nucleotide Adenine (A) always pairs with the nucleotide b. The nucleotide Guanine (G) always pairs with the...
1) The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... What is the nucleotide sequence of the DNA template strand from which it was transcribed? 2) If this mRNA is translated beginning with the first AUG codon in its sequence, what is the N-terminal amino acid sequence of the protein that it encodes?
Complete the following table and answer the next two questions (3.5 marts) 10 B I = U Ꭶ X2 x E I 19 эс ✓ C Finis DNA strand G C А DNA strand TAC TAC mRNA codon AUG C G G tRNA anticodon G - Amino acid Tryptophan Stop mRNA and tRNA are involved in producing proteins from genes in the DNA. One codon consisting of 3 nucleotides corresponds to an amino acid in the protein that gets built...
ԿԱՆՉՈ» 2. Genes are made of DNA nucleotides. The gene for the beta chain of hemoglobin is 1,734 nucleotides in length and is located on the human chromosome 11. The mutation responsible for sickle-cell anemia affects a single nucleotide, which in turn changes a single amino acid. (9 pt) a. How are these nucleotides joined together to form a long polynucleotide chain? Name the relevant nucleotide constituents important for making the linkage. (see Slides 5-7 of Lecture 4b) (2 pt)...
The sequence below represents the first section of the template strand of DNA of a structural gene in an prokaryotic organism. Position +1 is shown in orange. Please fill in the blanks that correspond YOUR RESPONSES SHOULD ALL BE IN UPPER CASE. Amino acid sequences should be written in the format ALA-TYR-LEU Stop codon is not written 3 GTAACTĀTAATTACGCGTATAATGAT 5 What would be the nucleotides that form the promoter? What would be the 5'UTR sequence? What would be the sequence...
please help with all 3
Incorrect Question 19 0/10 pts The sequence below represents the first section of the coding strand of DNA of a structural gene in an prokaryotic organism. Position +1 is shown in orange. Please fill in the blanks that correspond. YOUR RESPONSES SHOULD ALL BE IN UPPER CASE. Amino acid sequences should be written in the format ALA-TYR-LEU Stop codon is not written. 5' GTAACTATAATTATGCGTATAATG 3' What would be the nucleotides that form the promoter? GUAACUAU...