2. You observe a piece of mRNA. A few minutes later you see this mRNA has...
2. You observe a piece of mRNA. A few minutes later you see this mRNA has now been converted into DNA. How is this possible? Explain the protein responsible to do this. Also, what other sequences can this protein convert? What can this help researchers determine?
Homework Answers
The enzyme reverse transcriptase uses the mRNA template to produce a complementary single-stranded DNA strand called cDNA in a process known as reverse transcription. Next, DNA polymerase is used to convert the single-stranded cDNA into double-stranded DNA.
Reverse transcriptase is the protein that converts mRNA to DNA.
The process is called reverse transcription .
Used in polymerase chain reaction.
Add Answer to:
2. You observe a piece of mRNA. A few minutes later you see this
mRNA has...
You observe a piece of mRNA. A few minutes later you see this mRNA has now...
You observe a piece of mRNA. A few minutes later you see this mRNA has now been converted into DNA. How is this possible? Explain the protein responsible to do this. Also, what other sequences can this protein convert? What can this help researchers determine?
O ACTIVITY 5.4.1 Synthesis of a Protein: A Simulation Activity In this activity, you will be...
O ACTIVITY 5.4.1 Synthesis of a Protein: A Simulation Activity In this activity, you will be provided with the DNA nucleotide sequence that codes for a hypothetical protein. The code will be provided to you in three fragments. You will have to tran- scribe the code into mRNA, remove an intron segment, and translate the mRNA into the protein. In addition, you will have to identify the beginning fragment the middle fragment, and the end fragment. Sequence A TCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGC CGCCAGGGCCCCGCCCCTCAGAAGTTGGT...
can i get help with this question please Reference Sequence Wild-Type DNA Template Sequence: mRNA Sequence:...
can i get help with this question please
Reference Sequence Wild-Type DNA Template Sequence: mRNA Sequence: Amino Acid Sequence: TAC ACC TTG GCG ACG ACT AUG UGG AAC CGC UGC UGA Met-Top-Asn--Ars--Y-STOP NS. Mutated DNA Template Sequence #5: TAC ACC TTG GGA CGA CT Compare the mutated DNA#5 with the wild-type DNA sequence. Do you observe a substitution, deletion, or insertion mutation? The mRNA sequence derived from mutated DNA #5 is AUG UGG AAC CCU GCU GA Use Table 10.3...
Genetics Worksheet Week 3: Gene Regulation and Epigenetics 1. Duchenne muscular dystrophy is caused by a mutation in a gene that is 2.5 million nucleotides in length and encodes a protein called dyst...
Genetics Worksheet Week 3: Gene Regulation and Epigenetics 1. Duchenne muscular dystrophy is caused by a mutation in a gene that is 2.5 million nucleotides in length and encodes a protein called dystrophin. The dystrophin protein itself is 3684 amino acids in length. Calculate below the approximate size of the mRNA that encodes dystrophin. Approximately what percentage of the gene that encodes dystrophin is intron sequence? The human genome encodes a much greater variety and number of proteins than the...
Background Information How can we predict where a coding gene will be in bacteria? And can...
Background Information How can we predict where a coding gene will be in bacteria? And can we then predict what protein will be produced? Take the DNA sequence below, for example. tcaggctttaattcatccgtgatctttgacgacggtaaatacgatgcagatataatacgatgaccgatgccaatcgaccgatcaaggaggcaccgaatggcgatgatggcgatgattgcgattaacgaagtggaacgcattatggcgggcattaacgaagatacccatgcgaccggcgaaaacgaaaccatttgcagctgcgcgaactttgaagaactgacccatgcgaccggccgcgaagcgacctaaaagtcgtaattacgtatcaagtcatgggccgcgggcgcccggcccactgactagactagggccgggcgcccgcggcccaccatataaataaaaaaaaaaaaaacgaggctatagctcatcaatgacct If you were a bacterial RNA polymerase, what sequence(s) should there be in this DNA for you to bind and begin transcribing? And if you found such sequence(s), where would you begin transcription? As a human being looking at this fragment of DNA, what type of consensus sequence(s)...
C++: Translating mRNA sequence help Homework Description Codon 1 You are working in a bioinformatics lab...
C++: Translating mRNA sequence help
Homework Description Codon 1 You are working in a bioinformatics lab studying messenger RNA (mRNA) sequences. mRNA is a sequence of the nucleotide bases (Adenine, Cytosine, Guanine, and Uracil) that conveys information stored in DNA to Ribosomes for translation into proteins. The bases in the sequences are denoted by the first letters of the nucleotide bases (e.g. A, C, G, and U). A sequence of mRNA is made up of hundres to thousands of nucleotide...
INSTRUCTIONS You may print out this assignment and fill it in by hand. We suggest using...
INSTRUCTIONS You may print out this assignment and fill it in by hand. We suggest using pencil in case you make mistakes!! Submit your Assignment as a single doc on Canvas. ASSIGNMENT 1) For the DNA sequence given below, write the complementary DNA sequence that would complete the double-strand. DNA 3-A TTGCT TACTTGCA T-5° DNA 5 2) Does it matter which strand is the 'code strand'? The following two sequences look identical, except one runs 3-5' and the other 5'-3'....
What control elements regulate expression of the mPGES-1 gene? The promoter of a gene includes the...
What control elements regulate expression of the mPGES-1 gene? The promoter of a gene includes the DNA immediately upstream of the transcription start site, but expression of the gene can also be affected by control elements. These can be thousands of base pairs upstream of the promoter, grouped in an enhancer. Because the distance and spacing of these control elements make them difficult to identify, scientists begin by deleting sections of DNA that contain possible control elements and measuring the...
The following gene sequence has been obtained (only for the first few amino acids). You are...
The following gene sequence has been obtained (only for the first few amino acids). You are provided with the following gRNA spacer sequence to target a specific region of this gene: You are also provided with the following repair template sequence to introduce a specific mutation in this sequence through homology-directed repair (HDR): What is the mutation introduced by this repair template? What are the consequences of this mutation? (2pts) What would be possible sequences of two forward primers that...
Please help with 4-10! DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete th...
Please help with 4-10!
DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...
O ACTIVITY 5.4.1 Synthesis of a Protein: A Simulation Activity In this activity, you will be provided with the DNA nucleotide sequence that codes for a hypothetical protein. The code will be provided to you in three fragments. You will have to tran- scribe the code into mRNA, remove an intron segment, and translate the mRNA into the protein. In addition, you will have to identify the beginning fragment the middle fragment, and the end fragment. Sequence A TCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGC CGCCAGGGCCCCGCCCCTCAGAAGTTGGT...
can i get help with this question please
Reference Sequence Wild-Type DNA Template Sequence: mRNA Sequence: Amino Acid Sequence: TAC ACC TTG GCG ACG ACT AUG UGG AAC CGC UGC UGA Met-Top-Asn--Ars--Y-STOP NS. Mutated DNA Template Sequence #5: TAC ACC TTG GGA CGA CT Compare the mutated DNA#5 with the wild-type DNA sequence. Do you observe a substitution, deletion, or insertion mutation? The mRNA sequence derived from mutated DNA #5 is AUG UGG AAC CCU GCU GA Use Table 10.3...
Genetics Worksheet Week 3: Gene Regulation and Epigenetics 1. Duchenne muscular dystrophy is caused by a mutation in a gene that is 2.5 million nucleotides in length and encodes a protein called dystrophin. The dystrophin protein itself is 3684 amino acids in length. Calculate below the approximate size of the mRNA that encodes dystrophin. Approximately what percentage of the gene that encodes dystrophin is intron sequence? The human genome encodes a much greater variety and number of proteins than the...
C++: Translating mRNA sequence help
Homework Description Codon 1 You are working in a bioinformatics lab studying messenger RNA (mRNA) sequences. mRNA is a sequence of the nucleotide bases (Adenine, Cytosine, Guanine, and Uracil) that conveys information stored in DNA to Ribosomes for translation into proteins. The bases in the sequences are denoted by the first letters of the nucleotide bases (e.g. A, C, G, and U). A sequence of mRNA is made up of hundres to thousands of nucleotide...
INSTRUCTIONS You may print out this assignment and fill it in by hand. We suggest using pencil in case you make mistakes!! Submit your Assignment as a single doc on Canvas. ASSIGNMENT 1) For the DNA sequence given below, write the complementary DNA sequence that would complete the double-strand. DNA 3-A TTGCT TACTTGCA T-5° DNA 5 2) Does it matter which strand is the 'code strand'? The following two sequences look identical, except one runs 3-5' and the other 5'-3'....
Please help with 4-10!
DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...
Most questions answered within 3 hours.
-
In Visual Basic 2017, Write a complete Main method that prints
Hello, world to the screen....
asked 2 minutes ago -
a) Find the pressure difference on an airplane wing if air flows
over the upper surface...
asked 8 minutes ago -
Write an assessment of the current business analysis of Hilton
Worldwide using Porters 5 Forces analysis.
asked 19 minutes ago -
i need help on this
Chapter 9 Section 3 Question 1:
Rudy puts this poster, with...
asked 28 minutes ago -
True or false Assembly x86
41. _____ The program counter is a pointer to the
instruction....
asked 28 minutes ago -
You have conducted an experiment to try to demonstrate that
growth factor receptor X protein (GFRX)...
asked 44 minutes ago -
The Gross Profit ratio for 2014 is 57.07%
Assume that Campbell's net sales for the first...
asked 43 minutes ago -
Thoroughly discuss the various current and proposed solutions to
anthropogenic influences resulting in Global Climate Change....
asked 48 minutes ago -
BLOG EXERCISE: You are writing a weekly intranet blog for the
CEO of a large Canadian...
asked 51 minutes ago -
calculate ΔGrxn at 36 ∘C. N2O4(g)→2NO2(g)
asked 51 minutes ago -
Present and Future Values of Single Cash Flows for Different
Periods
Find the following values, using...
asked 53 minutes ago -
Which types of mutations in DNA can lead to the translation of a
non-functional protein product?...
asked 53 minutes ago