Answer ; C
Explanation - 5'-UGG-3' is the actual coding sequence for trptophan. An actual trp-tRNA shoud contain the anticodon sequence of 5'-CCA-3'. So if it recognizes UGA, then after getting mutated the sequence must be UCA.
QUESTION 11 A mutation in a bacterial gene generates a UGA stop codon in the middle...
1. Which one of the following describes the NORMAL FUNCTION of a stop codon in mRNA during bacterial protein synthesis? a. It is at the end of a mRNA molecule and terminates translation once the protein is completed. b. It prematurely terminates protein synthesis resulting in an incomplete protein. c. The 3 stop codons are UGA, UAG, and UGG. 2. A tRNA with an ACC anticodon will insert the amino acid ________ during translation. (Use your codon sheet, Fig. 6...
Genetic Code: The dictionary of the language of life Use the Genetic Code as a "dictionary" to solve the exercises on next page 5. If a mutation happens in the DNA that changes the T at base 14 to a G: a) What would be mutated sequence of nucleotides in the corresponding codon in the mRNA and the anticodon in the tRNA? Is there any change in the corresponding amino acid in the protein? b) What is the name of this type of...
Question 2 (1 point) In order to target a protein to the endomembrane system, which of the following is required first? O a ER bound ribosome signal peptide on the N terminus of the polypeptide chaperone protein signal peptide on the C terminus of the polypeptide O signal-recognition particles A tRNA is chemically modified so that the amino acid bound is different than the one specified by its anticodon. Which codon in the mRNA would the tRNA recognize: the one...
2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5') CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA (3') 3. DNA polymerase made a mistake and added a C on the DNA template strand. In...
Complete the following table and answer the next two questions (3.5 marts) 10 B I = U Ꭶ X2 x E I 19 эс ✓ C Finis DNA strand G C А DNA strand TAC TAC mRNA codon AUG C G G tRNA anticodon G - Amino acid Tryptophan Stop mRNA and tRNA are involved in producing proteins from genes in the DNA. One codon consisting of 3 nucleotides corresponds to an amino acid in the protein that gets built...
25. What binds to a stop codon on a mRNA during translation? a. transcription factor c. termination factor b. tRNA d. transcription initiator 26. What is typically attached to the acceptor end of a tRNA? a. a protein b. an amino acid C a ribosome d. a nucleosome 27. During mRNA processing, what is put on the 3' end of a primary mRNA transcript? a. a poly-A tail b. a cap d. an intron c. an exon 28. Which of...
6:35 5 minutes ago 25) Which of the following turns off transcription by binding to the operator? A) repressons B) lactose C) RNA polymerase D) promoters E) enzymes 25) 26) In bacteria, what name is given to a cluster of genes with related functions, along with their control 26) A) exon B) operon C) promoter D) activator E) regulatory gene A mutant bacterial cell has a defective aminoacyl synthetase that attaches a lysine to tRNAs with the anticodon AAA instead...
Please help me with biology 1. Online exercise: Find reports that document the relationship between the age of the mother and the risk for having a baby with Down Syndrome (Trisomy 21). For your interest only 2. Suppose that during transcription of a gene, RNA polymerase mistakenly inserts an incorrect base opposite the template DNA. This error results in an mRNA with an altered nucleotide sequence. Is this a mutation? For questions 3-10, consider the following mRNA, which is the...
50 LAB 2 Genetics EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise and answer the questions that follow. You will use the DNA strand from Exercise to make the protein for which it codes STEP 1 Review the imaginary strand of DNA below. Note the complementary base pairs. AGCAATCCGTCTTGG TCGTTAGG CAGAACC STEP 2 Draw the DNA strand separating down the middle las in the beginning of DNA replication STEP 3 Draw the free-floating RNA bases linking...
Week 14- Chapter 21 Homework Problem 21.72 < 52 of 58 Review Constants| Periodic Table Part A How does a point mutation for an enzyme affect the order of amino acids in that protein? Drag the terms on the left to the appropriate blanks on the right to complete the sentences. Reset Help then the order of amino acids will change in the of the polypeptide chain If the resulting codon still codes for the same amino acid, If the...