Question

1a) A band on an electrophoresis gel corresponds to _____ Choices: - the size standard -...

1a) A band on an electrophoresis gel corresponds to _____

Choices:
- the size standard
- millions of fragments of the same size
- a DNA fragment of a particular size
- the blue tracking dye

b) What is the function of the size standard?

Choices:
- it allows the researcher to calculate the unknown sizes of the DNA fragments by comparing then to then known sizes.
- it marks the location where the fragments should line up.

c) Longer fragments of DNA move through a gel faster then short fragments, because they contains more negatively charger phosphates.

Choices:
-true
-false
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Gel electrophoresis is a method which separates DNA based on the size using electric charge across a porous gel.

1a.
A band on an electrophoresis gel corresponds to a DNA fragment of a particular size.
The size is inferred based on the marker DNA(Size standard).
OPtion c is the answer.

b.
Size standard otherwise known as marker DNA allows one to calculate the unknown sizes of the DNA fragments by comparing it to
the marker DNA.
It contains DNA of different sizes which is spread like a ladder.

c.
Shorter DNA move faster than longer DNA.
Shorter DNA are at the base of the gel and longer DNA are the top of the gel and move slowly.
DNA fragments are negatively charged hence they move towards anode.
As all DNA fragments have same amount of charge per mass shorter DNA move faster than long DNA.
Hence the given statement is FALSE.

pls provide positive rating.

Add a comment
Know the answer?
Add Answer to:
1a) A band on an electrophoresis gel corresponds to _____ Choices: - the size standard -...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • can someone explain throughly on how to find a-c??? thanks!!! The following question will provide practice in interpreting and analyzing gel results. 5. You obtained the DNA electrophoresis gel be...

    can someone explain throughly on how to find a-c??? thanks!!! The following question will provide practice in interpreting and analyzing gel results. 5. You obtained the DNA electrophoresis gel below. Three samples of lambda phage DNA were digested with 3 different restriction enzymes and the digested DNA was applied to the gel in lane 4 and the bands were visualized. The Hind Ill digest was used as a molecular weight standard marker and produced 6 DNA fragments of known size:...

  • One strand of a DNA sequences is given below. Find the EcoRI sites and indicate the...

    One strand of a DNA sequences is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. CP22: vne strand of a DNA sequence is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Number of bases in each fragment: Now compare the same region of DNA from another individual. Where...

  • Hi I have a problem with number 5, it involves gel analysis results. There are 2 parts, a,b,c. For A Im sure you need to make a graph with distance in (cm) on the vertical axis and log10 bp on the hor...

    Hi I have a problem with number 5, it involves gel analysis results. There are 2 parts, a,b,c. For A Im sure you need to make a graph with distance in (cm) on the vertical axis and log10 bp on the horitzontal. I need help figuring out where to start and what to do. Please help! The following question will provide practice in interpreting and analyzing gel results You obtained the DNA electrophoresis gel below. Three samples of lambda phage...

  • Biologists use gel electrophoresis to sort DNA segments by size. DNA segments are placed at one...

    Biologists use gel electrophoresis to sort DNA segments by size. DNA segments are placed at one end of a gel. DNA is negatively charged (with a charge of two electrons per base pair). When you “run the gel” you are generating an electric field by connecting anodes and cathodes at the ends of the gel. This causes the negatively charged DNA segments to move towards the positive electrode. After running the gel, smaller DNA segments have moved farther from the...

  • Question 4-12 points Biologists use gel electrophoresis to sont DNA segments by size. DNA segments are...

    Question 4-12 points Biologists use gel electrophoresis to sont DNA segments by size. DNA segments are placed at one end of a gel. DNA is negatively chargod (with a charge of two electrons per base pair). When you "run the gel" you are generating an electric field by connecting anodes and cathodes at the ends of the gel This causes the negatively charged DNA segments to move towards the positive electrode. After nunning the gel, smaller DNA segments have moved...

  • Exercise IV. Fill in the Blank 1. The method of Centrifugation, polyacrylamide gel electrophoresis, western blotting,...

    Exercise IV. Fill in the Blank 1. The method of Centrifugation, polyacrylamide gel electrophoresis, western blotting, affinity purification) is the most widely used technique for determining the approximate molecular weight of a protein. 2. (Centrifugation, affinity chromatography, sonication, gel electrophoresis) is a method in which macromolecules are separated due to their size, charge, and other physical properties 3. SDS-PAGE is a form of electrophoresis in the presences of a/an (acidic solution, basic solution, anionic detergent, cationic detergent). 4. SDS not...

  • And.. Exercise1: Give the basic steps involved in extracting genomic DNA from animal cells and tossues?...

    And.. Exercise1: Give the basic steps involved in extracting genomic DNA from animal cells and tossues? 23- Which of the following statements is correct? a. Longer DNA fragments migrate farther than shorter fragments. b. Migration distance is inversely proportional to the fragment size. c. Positively charged DNA migrates more rapidly than negatively charged DNA. d. Uncut DNA migrates farther than DNA cut with restriction enzymes. 24- Why do scientists load DNA of known sizes (also called "marker" or "ladder") into...

  • L= No restriction B=Bam HI E=EcoRI H=Hind III Band 1 27mm 31mm 29mm 29mm Band 2...

    L= No restriction B=Bam HI E=EcoRI H=Hind III Band 1 27mm 31mm 29mm 29mm Band 2 NA 34mm 41mm 37mm Band 3 NA 41mm 46mm 43mm Band 4 NA 43mm 49mm 52mm Band 5 NA 46mm 57mm 71mm Band 6 NA NA NA 76mm Above is the actual measurements for the distance in mm. Please plug this in with the existing chart located above Gel Electrophoresis lab assignment The following sheets will be used to demonstrate your knowledge of gel...

  • looking for answers only questions #4 And #5 and #6 1 1 - + O Fit...

    looking for answers only questions #4 And #5 and #6 1 1 - + O Fit to page Page View A Read aloud Add notes 6 8 % 1. Why do individuals have two copies of each STR region? (Hint: Humans have maternal and paternal chromosomes.) Below is a DNA profile of three individuals using two different STRs: AGGCT and CAATG ) The DNA profile below shows the band pallerns of three individuals that resulted from gel electrophoresis separating the...

  • Hi can someone help me understand part C and why the drawn in red lines are...

    Hi can someone help me understand part C and why the drawn in red lines are where they are. Basically from the bp given how can I go back to cm so I can drawn them into the picture provided? Do not need help with A or B. The following question will provide practice in interpreting and analyzing gel results You obtained the DNA electrophoresis gel below. Three samples of lambda phage DNA were digested with 3 different restriction enzymes...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT