I quantified my extracted DNA using the Nanodrop 2000, which indicated a yield of 25 ng/ul....
I quantified my extracted DNA using the Nanodrop 2000, which indicated a yield of 25 ng/ul. How many picograms would I have in 3 ul of my sample?
Homework Answers
DNA yield = 25ng/ul
Amount of DNA in 3 ul = 75ng
Amount of DNA in picograms = 75 * 1000
( 1ng = 1000 pg )
= 75 
10
^3
pg.
Add Answer to:
I quantified my extracted DNA using the Nanodrop 2000,
which indicated a yield of 25 ng/ul....
Why do we want/need the presence of Mg2+ in a PCR but do not want it...
Why do we want/need the presence of Mg2+ in a PCR but do not want it present at all other steps of processing/analyzing a DNA sample? (2 marks) Identify and explain what generally occurs in each of the 3 main steps of a polymerase chain reaction. (6 marks) 8. Identify and explain what the 3 different PCR controls inform you about the results of a PCR. (3 marks) Highlight the 2 advantages and 3 disadvantages of using PCR. Ensure to...
I have my own answers, i just want to check my work, thanks! Given the DNA...
I have my own answers, i just want to check my work,
thanks!
Given the DNA sequence below: 3'-CGTCCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5' (Coding strand) 1. Replicate the corresponding template strand by using the aforementioned coding strand. Label the 5' and 3' ends in the new strand. 2. Transcribe the template strand to an mRNA sequence. 3. Find the start and stop codons on the mRNA and enclose it in a box or label with different color. 4. Write the amino acid sequence of...
I just need the answers to questions 2 and 3. My DNA ladder is in lane...
I just need the answers to questions 2 and 3. My DNA ladder is
in lane 2 with the yellow arrow pointing to it. Thanks!
Part 2: Gel purification and ration Gel Slice and PCR Product Preparation modified from IBSci.com instructions for gel and PCR clean-up system A. Dissolving the Gel Slice 1. Following electrophoresis, excise DNA band from gel and place gel slice in a 1.5ml microcentrifuge tube. 1b. Use an analytical balance to weigh gel slice. Record weight...
Using the PCR Thermocycler, the DNA sample was heated to what temperature? Group of answer choices...
Using the PCR Thermocycler, the DNA sample was heated to what temperature? Group of answer choices 99 Degrees Celsius 90 Degrees Celsius 95 Degrees Celsius 88 Degrees Celsius Flag this Question Question 21 pts We also used the microcentrifuge to spin our sample of cheek cells. Why is it important to balance the microcentrifuge? Group of answer choices Running a centrifuge with unbalanced load could permanently damage the centrifuge. It could also cause injury to you or someone else. Perfect...
I need the answers for questions 2 and 3. My DNA ladder is in lane 2...
I
need the answers for questions 2 and 3. My DNA ladder is in lane 2
marked by the yellow arrow. Thanks!
Here is the only other info I have. Thanks!
Part 2: Gel purification and on Gel Slice and PCR Product Preparin modified from TBSci.com instructions for gaan A. Dissolving the Gel Stie Following electrophores, eral DNA band from grand place glice microcentrifuge tube Ib. Use an analytical balance to weigh pelice Rec die 2. Add 500 balance to...
Q2 1 Point I want to pipette 87uL (microliters) of my sample. Which is the correct...
Q2 1 Point I want to pipette 87uL (microliters) of my sample. Which is the correct pipette to use? O P10 O P20 O P100 O P1000 Q3 1 Point If you were to dilute 30 uL of homogenate 1:5, how much water would you add to the sample (don't forget units)? Enter your answer here
I have no idea what clarification you need the question is as follows I don't understand...
I have no idea what clarification you need the
question is as follows I don't understand how to get the answer
4. For a ligation reaction, it is generally recommended to add Insert to Vector at a molecular ratio of 3:1 (three molecules of insert to one molecule of vector). If your vector and insert preparations have the same DNA concentration (in ng/ul), but your vector is 4500 base pairs long and your insert only 1500 base pairs, which volume...
A1 is my DNA, Enzyme 1 BsrB1 P1 is known pBR322 enzyme 1 A2 is my...
A1
is my DNA, Enzyme 1 BsrB1
P1 is known pBR322 enzyme 1
A2 is my dna enzyme 2 RSa1
p2 is known pBR322 enzyme 2
Au is my dna uncut
Pu is know pBR322 uncut
ladder Pu Au P, A, P2 Az HAAAM .. - וור RESULTS: Analyzing your data Tobbul Avdinol Answer the following questions: 1) How many bands do you see in the "uncut" lanes? If there are more than one band can you explain the nature...
You are using three restriction enzymes to digest a double-stranded DNA in which the sequence of...
You are using three restriction enzymes to digest a double-stranded DNA in which the sequence of the upper strand is 5'-TTGTCGATGCGAATTCGGTGATGGATCCTAGGTCGTGTAGCATGCATGCCGGATCCTAGCTGAGC'-3. The recognition sites of the enzymes are G'AATTC (EcoRI), G'GATCC (BamHI), and GCATG'C (SphI). The cleavage sites are indicated with '. Determine how long the DNA fragments will be after digesting the DNA with each of these enzymes individually. Additionally, determine the length of the fragments if you digest with both enzymes BamHI and SphI. In a drawing, show...
4. A genetic study conducted in 2003 indicated that up to 25% of men in one...
4. A genetic study conducted in 2003 indicated that up to 25% of men in one small province of Iran are direct descendants of one individual (historians and vampologists have speculated that it is most likely Nandor the Relentless). Suppose that we select 15 men at random from this province of Iran and observe whether or not this specific Y chromosome sequence occurs in their DNA. We consider a”success” to be an instance in which the individual is a direct...
I have my own answers, i just want to check my work,
thanks!
Given the DNA sequence below: 3'-CGTCCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5' (Coding strand) 1. Replicate the corresponding template strand by using the aforementioned coding strand. Label the 5' and 3' ends in the new strand. 2. Transcribe the template strand to an mRNA sequence. 3. Find the start and stop codons on the mRNA and enclose it in a box or label with different color. 4. Write the amino acid sequence of...
I just need the answers to questions 2 and 3. My DNA ladder is
in lane 2 with the yellow arrow pointing to it. Thanks!
Part 2: Gel purification and ration Gel Slice and PCR Product Preparation modified from IBSci.com instructions for gel and PCR clean-up system A. Dissolving the Gel Slice 1. Following electrophoresis, excise DNA band from gel and place gel slice in a 1.5ml microcentrifuge tube. 1b. Use an analytical balance to weigh gel slice. Record weight...
I
need the answers for questions 2 and 3. My DNA ladder is in lane 2
marked by the yellow arrow. Thanks!
Here is the only other info I have. Thanks!
Part 2: Gel purification and on Gel Slice and PCR Product Preparin modified from TBSci.com instructions for gaan A. Dissolving the Gel Stie Following electrophores, eral DNA band from grand place glice microcentrifuge tube Ib. Use an analytical balance to weigh pelice Rec die 2. Add 500 balance to...
Q2 1 Point I want to pipette 87uL (microliters) of my sample. Which is the correct pipette to use? O P10 O P20 O P100 O P1000 Q3 1 Point If you were to dilute 30 uL of homogenate 1:5, how much water would you add to the sample (don't forget units)? Enter your answer here
I have no idea what clarification you need the
question is as follows I don't understand how to get the answer
4. For a ligation reaction, it is generally recommended to add Insert to Vector at a molecular ratio of 3:1 (three molecules of insert to one molecule of vector). If your vector and insert preparations have the same DNA concentration (in ng/ul), but your vector is 4500 base pairs long and your insert only 1500 base pairs, which volume...
A1
is my DNA, Enzyme 1 BsrB1
P1 is known pBR322 enzyme 1
A2 is my dna enzyme 2 RSa1
p2 is known pBR322 enzyme 2
Au is my dna uncut
Pu is know pBR322 uncut
ladder Pu Au P, A, P2 Az HAAAM .. - וור RESULTS: Analyzing your data Tobbul Avdinol Answer the following questions: 1) How many bands do you see in the "uncut" lanes? If there are more than one band can you explain the nature...
Most questions answered within 3 hours.
-
1. What is the meaning of the term communication style?
2. What are the benefits to...
asked 12 minutes ago -
9.) You are buying a car that cost $26,500. You make payments of
$412 each month...
asked 36 minutes ago -
. Suppose a discrete random variable has probability
distribution
P(x) = .2 if x = 0...
asked 1 hour ago -
Problem #1
The area between Z = 0 and Z = 2.50
The area between Z...
asked 53 minutes ago -
Under the influence of its drive force, a snowmobile is moving
at a constant velocity along...
asked 2 hours ago -
Why do organizations decline? What steps can top
management take to halt, decline, and restore organizational...
asked 2 hours ago -
What mechanisms Drive speciation??
(I.e. what was Dawins theory on the orgin of species, and how...
asked 3 hours ago -
The manager at a car assembly plant believes that the mean
assembly time for a car...
asked 4 hours ago -
Which of the following is true of electron capture?
A) It decreases the nuclide's mass number...
asked 6 hours ago -
Assuming an efficiency of 43.10%, calculate the actual yield of
magnesium nitrate formed from 114.9 g...
asked 6 hours ago -
The highly pathogenic bacterium Clostridium
perfringens causes gangrene, a disease that results in the
destruction of...
asked 8 hours ago -
In the context of situation analysis, which of the following is
a category for analysis in...
asked 8 hours ago