Q1)
Which of these best describes the resistance marker? (1 mark)
Select one:
a. A sequence of DNA which encodes for a protein that gives the cells antibiotic resistance.
b. A sequence of DNA which initiates replication and from which DNA replication proceeds.
c. A sequence of DNA which contains recognition sites for many restriction endonucleases.
d. A sequence of DNA which can be used in agarose gel electrophoresis to determine the size of the DNA molecules
Q2)
Which of these best describes the origin of replication? (1 mark)
Select one:
a. A sequence of DNA which initiates replication and from which DNA replication proceeds.
b. A sequence of DNA which can be used in agarose gel electrophoresis to determine the size of DNA molecules.
c. A sequence of DNA which contains recognition sites for many restriction endonucleases.
d. A sequence of DNA which encodes for a protein.
e. A sequence of DNA used to identify and/or select for transformed cells.
Ans.1) (A) A sequence of DNA which encodes for a protein that gives the cells antibiotic resistance.
Explanation:-
resistance marker is a gene that produces a protein that provides cells expressing this protein with resistance to an antibiotic.
Ans.2)(A) A sequence of DNA which initiates replication and from which DNA replication proceeds.
Explanation:-
An origin of replication is a sequence of DNA at which replication is start. For small DNAs, including bacterial plasmids and small viruses, a single origin is sufficient but in eukaryotes DNAs have many origins, and DNA replication is initiated at all of them.
Q1) Which of these best describes the resistance marker? (1 mark) Select one: a. A sequence...
Q1) Which of these best describes the multiple cloning site (MCS)? (1 mark) Select one: a. A sequence of DNA which can be used in agarose gel electrophoresis to determine the size of DNA molecules. b. A sequence of DNA which contains recognition sites for many restriction endonucleases. c. A sequence of DNA used to identify and/or select for transformed cells. d. A sequence of DNA which initiates replication and from which DNA replication proceeds. e. A sequence of DNA...
You are performing an analysis of squirrel mitochondrial DNA, which is a circular double-stranded DNA molecule that is 23,000 bp in length. You are using restriction enzymes and agarose gel electrophoresis in your experiments. You have decided to use two restriction endonucleases: Pstl and Tagl. The picture below shows their recognition sites, and the red arrows indicate their strand- Pstl (Providencia stuartii) CTGCAG GACGTC specific cleavage sites. Taqi (Thermus aquaticus) TCGA AGCT Part A: The Pstl and Taql enzymes both...
hi I need help with these questions please
q1 How long is the DNA sequence encoding the protein that
confers ampicillin resistance (in bp units)? Input one number only,
with no spaces or units. (1 mark)
q2 How long is the DNA sequence encoding the protein that
confers hygromycin resistance (in bp units)? Input one number only,
with no spaces or units. (1 mark)
q3 What is the size of the OTC-Δ DNA sequence that has been
inserted into the...
Write true or false ______ 1. The DNA sequence of one human being is on average 99.9% identical to another random human being. ______ 2. As of 2009, all living human beings have had their entire genome sequenced. ______ 3. The nucleotide bases present in a DNA sequence are A, U, G, C. ______ 4. Techniques that enabled scientists to clone genes were developed in the 1970s. ______ 5. A restriction enzyme is useful because it is a generic enzyme...
Luestion 3 1 pts Review: You have the DNA that is radioactively labeled at the S'ends of DNA as shown below. But you want DNA that is labeled only at one end of the DNA, not both ends. One of the other undergraduate students in the lab suggests that you use a restriction enzyme to cut the DNA, then electrophorese the DNA in an agarose gel, then cut out the region of the gel with radioactive DNA fragment you want,...
(Choose the best answer) A polylinker increases the versatility of a DNA plasmid because it contains: a DNA recognition sequence for several different restriction enzymes. an antibiotic resistance cassette that allows selection in multiple different species. an origin of replication that is not organism-specific. a reverse transcriptase sequence. A BamHI restriction enzyme recognition sequence. cDNA libraries are the same as genomic libraries. include DNA from noncoding sequences. require DNA polymerase for their construction. require reverse transcriptase for their construction. are...
15- Which option BEST describes sticky ends by restriction enzymes B. Sticky ends A. Sticky ends are DNA fragments that carry a higher charge than normal after they have been cleaved are DNA fragments cleaved by a restriction enzyme so that one strand is longer than the other C. Sticky ends are DNA fragments cleaved by a restriction enzyme so that both strands are the same length. D. Sticky ends are DNA fragments that attract a carbohydrate molecule to one...
Chromosomal and plasmid DNA can be cut into manageable pieces by
restriction enzymes. Using agarose gel electrophoresis, the DNA
fragments can be separated on a gel, based on their lengths. In
order to see the fragments, a stain is typically added to the gel.
The size of each fragment can be determined by comparing each one
to a DNA molecular weight marker of known size.
Below is a map of pBR22 plasmid. The position and base pair
number of the...
QUESTION 18 Which of the following enzymes will produce a blunt end (the cut site is indicated by the * in the recognition sequence)? NsiI (ATGCA*T) EcoRV (GAT*ATC) TaqI (T*CGA) EagI (C*GGCCG) QUESTION 19 Which of the following is a functional element of a plasmid? drug-resistance gene origin of replication sequence encoding a restriction endonuclease polylinker sequence QUESTION 20 Next generation sequencing is much more efficient than the Sanger method because: it uses gel electrophoresis to resolve end-labeled strands...
One strand of a DNA sequences is given below. Find the
EcoRI sites and indicate the cutting site with an arrow. Count the
number of bases in each fragment.
CP22: vne strand of a DNA sequence is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Number of bases in each fragment: Now compare the same region of DNA from another individual. Where...