Question

A: The gene that codes for the rho protein in a specific species of bacteria is...

A: The gene that codes for the rho protein in a specific species of bacteria is deleted. What function is likely lost because of this deletion? Be specific.

B: What role does the TBP (TATA-Binding Protein) play in transcriptional initiation?

C: What is the purpose of having a 5’ CAP on eukaryotic mRNA?

D: Where do processed mRNA’s go after leaving the nucleus and how?

Please answer and explain

E: Explain the role of snRNPs in RNA processing. Be specific.

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Date: Page no: Anuwen Rho gene Rho protein hexmen of single polypeptide (14909) Rho protein haave Capability to bind with RNADate: Page no: o purpose of having a s cap on miRNA 5 Cap is a part of RNA processing many enzyme are helpful en processingthane rabubaka Send hand Date:_ Page no: E role of SnRaps in processing - Removing of intron - SnRNA & protein (U, V2 y, us u

Add a comment
Know the answer?
Add Answer to:
A: The gene that codes for the rho protein in a specific species of bacteria is...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Describe how to control transcriptional initiation occurs in both PROKARYOTES and EUKARYOTES. Word bank: promoter   TATA-Binding...

    Describe how to control transcriptional initiation occurs in both PROKARYOTES and EUKARYOTES. Word bank: promoter   TATA-Binding Protein (TBP)   RNA polymerase + sigma factor enhancer    TATA-box       gene-specific transcription factors RNA polymerase + GTFs   phosphodiester bonds    -10 and -35 consensus sequences mediator protein   +1 Transcriptional Start Site (TSS)   deoxynucleoside triphosphates (dNTPs) template DNA RNA transcript.

  • OK. So, this week we’re investigating the eukaryotic gene PPtrl, which codes for the Rbbl protein....

    OK. So, this week we’re investigating the eukaryotic gene PPtrl, which codes for the Rbbl protein. You painstakingly derived a segment of the transcribed sequence of this gene, which is listed below. What would be the mRNA sequence that corresponds with this segment? coding 5’ A T G C G T A A T G C T A 3’ template 3’ T A C G C A T T A C G A T 5’ mRNA 5’ A U G...

  • QUESTION 1 QUESTION 5 QUESTION 11 Identify the components required for translation initiation in bacteria What...

    QUESTION 1 QUESTION 5 QUESTION 11 Identify the components required for translation initiation in bacteria What is the enzymatic component of the ribosome? A Protein Identify the TRANS components of the transcription initiation complex in bacteria ATFIE Bir RNA C. TATA BOX D-10 and 35 sequences E Signa factor B. Carbohydrates C.RNA CATFIE B. 5methyl guanosine cap C. Shine-Dalgamo Sequence D. Sigma factor CETFIID (TBP and TAFS) FTFIIB G. Initiator RNA H.10 and 35 sequences EL Smal ribosomal subunit J....

  • What is the function of the TATA binding protein (TBP)? Group of answer choices aids in...

    What is the function of the TATA binding protein (TBP)? Group of answer choices aids in the removal of introns from eukaryotic pre-mRNA allows prokaryotic RNA polymerase to bind to the promoter of genes allows eukaryotic RNA polymerase II to bind to the promoter of genes helps termination factors bind and terminate transcription. All of the answer options are correct.

  • 3. Prokaryotic and eukaryotic gene expression compared. Below is an incomplete table of prokaryotic and eukaryotic...

    3. Prokaryotic and eukaryotic gene expression compared. Below is an incomplete table of prokaryotic and eukaryotic gene expression in comparison. Fill in the blank using PPT slides, notes and the textbook. Prokaryotic gene expression Eukaryotic gene expression Overview Steps Transcription and translation Yes Transcription and translation coupled? Gene structure No introns Epigenetic modification (chromosome remodeling) transcription, translation, RNA processing, protein processing Transcription in the nucleus and translation in the cytoplasm Interrupted gene with exons and introns RNAPI, II, III Which...

  • choose the right answer : 1- what is degradation of ' unwanted' proteins in eukaryotic cells...

    choose the right answer : 1- what is degradation of ' unwanted' proteins in eukaryotic cells A- polyribosomes B- proteasomes C- editosome D- spliceosomes 2- addition or deletion of bases causes which kind of mutation A- transition B- transcription C- transversion D- frameshift mutation 3- point mutation involve : A- change in single base pair B- deletion C- duplication D- insertion 4- what is the complementary m-RNA sequence for the DNA sequence C-A-A-G-G-T A- C-A-A-G-G-U B- G-U-U-C-C-A C- C-A-A-G-G-T D-...

  • Which of the following statements regarding the TATA binding protein (TBP) are true: Recognizes a sequence...

    Which of the following statements regarding the TATA binding protein (TBP) are true: Recognizes a sequence that is similar are identical to 5'TATAAA3' Ο Ο Ο All are correct. It is considered a universal transcription factor It is a part of TEIID protein complex It binds to a consensus sequence The backbone of a DNA molecule is made up of phosphate groups made up of sugars made up of alternating phosphate and sugar groups Made up of alternating sugars and...

  • Once researchers identified DNA as the unit of inheritance, they asked how information was transferred from...

    Once researchers identified DNA as the unit of inheritance, they asked how information was transferred from the DNA in the nucleus to the site of protein synthesis in the cytoplasm. What is the mechanism of information transfer in eukarotes? Transfer RNA takes information from DNA directly to a ribosome, where protein synthesis takes place. DNA from a single gene is replicated and transferred to the cytoplasm, where it serves as a template for protein synthesis. Proteins transfer information from the...

  • 5. The sequence of a complete eukaryotic gene encoding the small protein Met Tyr Arg Gly Ala is shown here. All of the...

    5. The sequence of a complete eukaryotic gene encoding the small protein Met Tyr Arg Gly Ala is shown here. All of the written sequences on the template strand are transcribed into RNA. 5' CCCCTATGCCCCCCTGGGGGAGGATCAAAACACTTACCTGTACATGGC 3' 3' GGGGATACGGGGGGACCCCCTCCTAGTTTTGTGAATGGACATGTACCC 5' a. Which strand is the template strand? [2 pts] b. Which direction (right-to-left or left-to-right) does RNA polymerase move along the template as it transcribes this gene? [2 pts] c. What is the sequence of the nucleotides in the processed (mature)...

  • Your friend decides to place Green Fluorescent Protein (GFP) under the control of the promoter from...

    Your friend decides to place Green Fluorescent Protein (GFP) under the control of the promoter from the lacZ gene we discussed in class. She put this expression plasmid into a bacterium. The promoter from the lacZ gene is diagrammed to the right.? 2) Your friend decides to place Green Fluorescent Protein (GFP) under the control of the promoter from the lacZ gene we discussed in class. She put this expression plasmid into a bacterium. The promoter from the lacZ gene...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT