3) False,Because Taq Polymerase used in PCR is heat resistant.
4)The reverse primer attaches to 3 prime end of complementary strand.
5)The forward primer attaches to the 3 prime end of template strand.
please help im lost!!! please help me with 3,4,5 D 3. True or false? The Taq...
True or false? The forward primer attaches to the 5 prime end of the minus(-) strand. True or false? The reverse primer attaches to the 3 prime end of the plus(+) strand. Can you explain why as well im not fully understanding this, thank you.
please help me with both of these questions!!!! 3:33 PM Wed Mar 18 Enter answer... 5:06 Exit You are trying to amplify an eye color gene in Drosophila. Based on the DNA sequence for the gene, you design the following primers: Forward Primer: 5' GCATGCTGAG CCTAGTAACT 3 Reverse Primer: 5' CTTAAAGCTT ACTGGTCAAC 3' True or false? These are good primers to use in PCR. Hint: use the formula: Tm (in C) = 4(G+C) + 2(A + T) True False ormula:...
please help me!!!!!!!!! do both i need help Dz. You are creating PCR primers for the DNA sequence pictured. If the given sequence is the plus strand, what would be the reverse primer? (Type the primer in 5' to 3' orientation without spaces) 5' GTACTGCCAT TCGTAACTGT GTACTCAAGT AATGCCTGTC CATCATGTAA ATTGCATGGC CCTGATTGGA TATGCCAAAG GCTTTTGCAA GTCCCCATAG GTACTGGACA GTAGTACGTT GTCCTGAGGC GCGCTATAGG GTCGAAACTG 3 Enter answer. D8 You are creating PCR primers for the DNA sequence pictured. If the given sequence is the plus...
Please help with all questions. I provided all the information that I have. The sequence below represents the genomic DNA sequence of the first 440 bp of your gene of interest (exon 1 in blue). You want to amplify this full 440 bp region by PCR, for cloning into a plasmid vector. tgaagtccaactcctaagccagtgccagaagagccaaggacaggtacggctgtcatcacttagacctcaccctgtggagccacaccctagggttggccaatctactcccaggagcagggagggcaggagccagggctgggcataaaagtcagggcagagccatctattgcttacatttgcttctgacacaactgtgttcactagcaacctcaaacagacaccatggtgcatctgactcctgaggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggttgctatcaaggttacaagacaggtttaaggagaccaatagaaactgggcatgtggagacagagaagactcttgggtttctgataggcactgactctctctgcctattggtctattttcccaccc 1.1 Design a 20 nucleotide forward & reverse primer set that will allow you to amplify the sequence above. (note - primers should be at the beginning...
iew the video to determine whether each statement is true or false. og "True" or "False" to the end of each statement. Reset Help True The template DNA for the leading strand is easier to unwind than the template DNA for the lagging False strand The rate of DNA synthesis from each primer is expected to be faster on the leading strand than on the lagging strand More primers are expected to be used in the synthesis of the lagging...
Review the video to determine whether each statement is true or false, Drag "True" or "False" to the end of each statement. Reset Help True More primers are expected to be used in the synthesis of the lagging strand than in the synthesis of the False leading strand. The template DNA for the leading strand is easier to unwind than the template DNA for the lagging strand. strand. O The rate of DNA synthesis from each primer is expected to...
NEED HELP WITH THESE QUESTIONS. PLEASE ANSWER ALL AND EXPLAIN AS WELL. THANKSSSSSSS 1. You want to clone a gene from a donor vector to a host vector. List the correct order of events in the process of cloning a. Perform ligation reaction of cloned gene and host vector. b. Perform double digestion of both donor and host vectors with the 2 restriction enzymes c. Examine donor and host vectors for restriction sites d. Purify cloned gene from donor vector...
NEED HELP!! I am a little lost DNA Template Used in Forensic Identification: TATTGTACGG TACCATAAAT ACTTGACCAC CCACCATGAA CTGTAGTACA CCCATGCTTA TAAAAACCCA ATCCACATCA AAACCCCCTC CAAGCAAGTA CAGCAATCAA CCCCCCCTA CCTCACCCAC TCACACATCA АСТcccccтс CAAAGCCACC TAGGATACCA ACAAACCTAC CCACCAGGAA CAGTACATAG TACATAAAGC CATTTACCGT ACATAGCACA TTACAGTCAA АТсссттстс GTCCCCATGG ATGACCCCCC TCAGATAGGG Forward primer: Reverse primer: QAT Restriction Enzyme Recognition Sequence: 6CC GGS a) Label the 5' end of the template, primer, and restriction recognition sequences. 1 point b) Underline (on the above template sequence the primer binding sites. 1 point...
help with the whole question 9 please. 9. a) You are tasked with amplifying a fragment of interest from a sample of genomic DNA by using PCR List the components that need to be included in any standard PCR, give the function of each. A PCR is typically performed in an automated thermo cycling machine. Give the three steps required in each cycle, and explain the function of each. The figure below represents a step during the first PCR cycle....
Please help me with these questions. Thank u very much. Q1: A DNA sample from an individual is analyzed. The population frequency of one of the STR alleles is 1 in 50, a second STR allele is 1 in 100, and a third STR allele is 1 in 30. What is the combined frequency of these three STR alleles? a.1 in 150,000 b.1 in 15,000 c.1 in 1,500 d.1 in 180 e.1 in 50 Q2: Which of the following hybridize...