when designing primers for PCR GC rich sequences are often chesen DNA code what is this...
Homework Answers
Following are the reason for using high GC content primer-
GC rich sequence has strong binding with the complementary strand and are more stable. At the 3' end out of 5 at least 2 nucleotides should be G/C because they make stronger bond than A/C.
GC content increases the temperature for annealing. This prevents the formation of hairpin loop (only when melting temperature of hairpin loop is less than annealing temperature) within the primer. Formation of hairpin loop within the primer prevents replication of DNA.
Add Answer to:
when designing primers for PCR GC
rich sequences are often chesen DNA code
what is this...
The DNA primers used in PCR are a. complementary to DNA sequences at both ends of...
The DNA primers used in PCR are a. complementary to DNA sequences at both ends of the DNA sequence of interest. b. attached to the gene of interest by ligase. c. produced when a gene of interest is read by restriction enzymes. d. identical to the entire base sequence of one strand of the DNA.
PCR utilizes specific DNA primers and polymerase enzyme to make copies of particular DNA sequence. The...
PCR utilizes specific DNA primers and polymerase enzyme to make copies of particular DNA sequence. The primers must attach to separated DNA at the target sequences so that the polymerase can build new DNA strands. What must also be added to the mixture besides primers and polymerase enzyme in order to get amplification and DNA? a. RNA polymerase b. dNTPs c. electron carriers d. DNA repair enzymes
(4 pts) You are designing new PCR primers for MLST and need to identify a gene...
(4 pts) You are designing new PCR primers for MLST and need to identify a gene to U r these primers. Describe two parameters of the gene that are important to conside your design
Cells use RNA strands to serve as primers. PCR techniques for amplifying DNA samples use pre-synthesized...
Cells use RNA strands to serve as primers. PCR techniques for amplifying DNA samples use pre-synthesized DNA primers. Explain why RNA primers are not used when replicating DNA fragments in vitro.
4. (1.5 pts)You are practicing designing primers that you can use in PCR reactions. You want...
4. (1.5 pts)You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below. 5°-АсттсслтАTстсТАЛААТАССАТCGATСтстсссссстАGстAСCТААССАGAGACCСТАССG-3. 3-тслАсстатАсAGATTTTATсстасстаGлCAссссССATCCATCGAтTСстстстасGAТСCС-5. Markers part (a) part (b) part ck Right primer should anneal to this region Left primer should 87 nts anneal to this region 80 nts 70 nts 60 nts 50 nts 40 nts 27 nts Draw into the following gel lanes what size(s) of PCR products you would get if you...
100 AT-rich DNA Denaturation (%) GC-rich DNA 75 80 85 90 95 100 105 110 115...
100 AT-rich DNA Denaturation (%) GC-rich DNA 75 80 85 90 95 100 105 110 115 120 125 Temperature (°C) What is the im of the most AT-rich DNA sample?
Write the sequences of the two 12-residue primers that could be used to amplify the following...
Write the sequences of the two 12-residue primers that could be used to amplify the following DNA segment by PCR. ATAGGCATGGCCTTAAACGCTAGCTTGCAACGTTACGGTCAATGCCGTAACGTTGCA
DNA from 100 unrelated people was amplified by PCR with allele specific primers, The PCR products...
DNA from 100 unrelated people was amplified by PCR with allele specific primers, The PCR products were separated and visualized on the following gel. A specific fragment was found to correspond to each blood group allele, indicated on the left hand side. The number of individuals with each gel pattern is shown across the top. 7351-749, 18 Assuming random mating, what is the expected frequency of Type B blood? А 0.0025 0.070 C. 0.0725 D 0.25 E 0.05
EXPLAIN each answer thoroughly. There are two common goals when using PCR to amplify DNA. A....
EXPLAIN each answer thoroughly. There are two common goals when using PCR to amplify DNA. A. Make lots of copies of a specific DNA sequence to use in cloning (preparative PCR) B. Detect the presence or relative amount of a specific gene under varying conditions (analytical PCR) *Remember: PCR is very similiar to DNA replication, but uses a DNA polymerase to amplify only specific parts of DNA sequence based on the sequence of the primers. 3. For which goal (A...
1. What are the degenerate primers in the PCR amplification protocol? What do they do? 2....
1. What are the degenerate primers in the PCR amplification protocol? What do they do? 2. Suppose you begin a PCR reaction with 1 piece of double stranded DNA. After 30 cycles of replication, how many pieces of double stranded DNA do you now have? 3. What would be the consequence of having too much DNA in the sample? Would it interfere with the PCR reaction? Why? 4. What happens during the annealing step of the PCR reaction? During the...
(4 pts) You are designing new PCR primers for MLST and need to identify a gene to U r these primers. Describe two parameters of the gene that are important to conside your design
4. (1.5 pts)You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below. 5°-АсттсслтАTстсТАЛААТАССАТCGATСтстсссссстАGстAСCТААССАGAGACCСТАССG-3. 3-тслАсстатАсAGATTTTATсстасстаGлCAссссССATCCATCGAтTСстстстасGAТСCС-5. Markers part (a) part (b) part ck Right primer should anneal to this region Left primer should 87 nts anneal to this region 80 nts 70 nts 60 nts 50 nts 40 nts 27 nts Draw into the following gel lanes what size(s) of PCR products you would get if you...
100 AT-rich DNA Denaturation (%) GC-rich DNA 75 80 85 90 95 100 105 110 115 120 125 Temperature (°C) What is the im of the most AT-rich DNA sample?
DNA from 100 unrelated people was amplified by PCR with allele specific primers, The PCR products were separated and visualized on the following gel. A specific fragment was found to correspond to each blood group allele, indicated on the left hand side. The number of individuals with each gel pattern is shown across the top. 7351-749, 18 Assuming random mating, what is the expected frequency of Type B blood? А 0.0025 0.070 C. 0.0725 D 0.25 E 0.05
1. What are the degenerate primers in the PCR amplification protocol? What do they do? 2. Suppose you begin a PCR reaction with 1 piece of double stranded DNA. After 30 cycles of replication, how many pieces of double stranded DNA do you now have? 3. What would be the consequence of having too much DNA in the sample? Would it interfere with the PCR reaction? Why? 4. What happens during the annealing step of the PCR reaction? During the...
Most questions answered within 3 hours.
-
The denaturation of proteins can be described by the
equilibrium
F⇌U
where F and U represent...
asked 1 hour ago -
Please answer what the maximum and minimum force is, and the
angle on the ion is...
asked 1 hour ago -
implement a program that reads a number of rows and a symbol.
The program will draw...
asked 1 hour ago -
Assume that when adults with smartphones are randomly selected,
45% use them in meetings or classes....
asked 1 hour ago -
Determine the number of formula units of
Na2SO4 and moles of oxygen contained in 8.11
moles...
asked 1 hour ago -
Explain in steps on the following code
What would be the output when executed
using System;...
asked 1 hour ago -
Given the information in the table, which of the following
statements is CORRECT?
Stock A
Stock...
asked 1 hour ago -
Write MARIE assembly language programs that do the following:
Write a program that inputs an integer...
asked 1 hour ago -
Explain an understanding of services and protocols.
Explain the job of DNS.
Explain the three email...
asked 2 hours ago -
(As soon as possible) Balance each of the following equations
according to the half-reaction method:
H2O2(aq)...
asked 2 hours ago -
A thin rod with a mass of 3.5kg and a length L=1.5 m is oriented
horizontally....
asked 2 hours ago -
Inheritance pattern in BRCA 1
Describe the inheritance pattern of BRCA 1 Is it recessive or...
asked 2 hours ago