ZuoTi.Pro
Question

Consider the diagrammatic view of a DNA replication fork below: 000 Indicate the direction of the bottom parental strand, fro correct? .
science   biology   
0 0
Add a comment Improve this question Transcribed image text
Next > < Previous
Sort answers by oldest

Homework Answers

Answer #1

Answer: DNA has two strands, the upper strand is in 5' -3' direction and the bottom strand is in 3' -5' direction. During replication, the two parental strands separate and the DNA replication machinery synthesis new DNA strand continuously using upper parental strand as template and discontinously using bottom parental strand as template. Hence, the correct answer is option C (3'-5' direction) and the options are incorrect.

0 0
Add a comment
Know the answer?
Add Answer to:
correct? . Consider the diagrammatic view of a DNA replication fork below: 000 Indicate the direction...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions

  • Consider the diagrammatic view of a DNA replication fork below: X If the left-hand side of...

    Consider the diagrammatic view of a DNA replication fork below: X If the left-hand side of the depicted DNA molecule is the end of the chromosome, which of the parental strands—UPPER or LOWER- will be elongated by a telomerase? O Lower O It cannot be inferred from the information given Both Upper

  • The following is an image of a section of dna. if a replication fork is moving...

    The following is an image of a section of dna. if a replication fork is moving from right to left, which strand (top or Bottom) is the template strand for the leading strand. 3' AAATCGCGATCGATGGTCTGAGTTTGAATC 5' 5' TTTAGCGCTAGCTACCAGACTCAAACTTAG 3'

  • SO MMD WON Parental strands Daughter strands 2) Considering the DNA replication fork shown above, with...

    SO MMD WON Parental strands Daughter strands 2) Considering the DNA replication fork shown above, with the 5' end of one daughter strand marked, what end of DNA (5' or 3') should occur on the parental strand at the position marked with an 'X'? a) 5' b) 3 c) Either 5' or 3', both are equally possible d) Impossible to determine with the information given

  • 5a. For the replication fork shown below: - label the leading and lagging strands; - draw...

    5a. For the replication fork shown below: - label the leading and lagging strands; - draw arrows to indicate which direction DNA synthesis is proceeding in for each of these strands; - label their 5' and 3' ends. Replication fork movement →→→ 5'-ATCTGGCAGTACGTACTGGATC CGUCAUGC GTCGAATCTGAC-3' CAGCTTAGACTG-5' ATCTGGCTATTCGT 3'-TAGACCGATAAGCATGACCTAG b. Okazaki fragments are generated during (leading / lagging) strand synthesis (circle the correct answer). c. Some U's are included in one of the strands in the figure. Why are there U's...

  • Vocabulary: DNA Replication

    Vocabulary: DNA Replication A. Helicase B. Primase C. Single Strand Binding Protein (SSB) D. Topoisomerase E. Origin of Replication F. DNA Polymerase G. Leading Strand H. Lagging strand I. DNA Ligase J. Okazaki Fragment K. Replication Fork L. RNA Primer M. Topoisomerase .1. Site where the replication of a DNA molecule begins. 2. The new continuous complementary DNA strand synthesized in the direction for the replication fork. 3. A discontinuously synthesized DNA strand that elongates in a direction away from the replication fork 4. Relaxes...

  • Below is a figure of a DNA molecule undergoing replication. The arrow indicates the direction the...

    Below is a figure of a DNA molecule undergoing replication. The arrow indicates the direction the replication fork is moving during synthesis. From the list provided, indicate which option fits best in each box on the diagram. 21       [ Choose ]            leading strand            template strand            lagging strand       22       [ Choose ]            leading strand            template strand            lagging...

  • 1) Draw a diagram of a bacterial replication fork showing the leading and lagging strand of...

    1) Draw a diagram of a bacterial replication fork showing the leading and lagging strand of new DNA and the enzymes responsible for the processes involved. Indicate the 3' and 5' end of each nucleic acid strand. 2) The ends of a linear chromosome cannot be replicated by the normal DNA replication enzymes. Why? How does the eukaryotic cell solve this problem?

  • 11. Several enzymes and proteins participate in DNA replication. Answer the fill in the blan below...

    11. Several enzymes and proteins participate in DNA replication. Answer the fill in the blan below bonds unwinds DNA by breaking the a. The enzyme between the nitrogenous bases bind to single-stranded DNA to stabilize it and to prevent it from reannealing to the other DNA strand. makes DNA This enzyme adds nuceotides to the end of a nucleic acid strands; therefore, it makes DNA in the to direction . DNA Polymerase cannot put two nucleotides together, instead, it adds...

  • 2. Draw replication fork, and place and label the following -DNA being copied (template)-new D -...

    2. Draw replication fork, and place and label the following -DNA being copied (template)-new D - Correct 5' and 3' markings NA-helicase -primaseleading strand and Okazaki fragments

  • Figure 1 illustrates a model of the molecules involved in DNA replication and their placement relative...

    Figure 1 illustrates a model of the molecules involved in DNA replication and their placement relative to each other. Topoisomerase Helicase NNNNNNN Sam 11UUU -RNA HHHHHHH5 Figure 1. Model including molecules involved in DNA replication Which of the following correctly explains where DNA replication will begin on the strand oriented 5' 3', reading from left to right? (A) DNA replication will be randomly initiated along the unwound portion of the DNA strand since base pairing will occur. DNA replication cannot...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT