Hydrophobic interactions may occur between the R-groups of which of the following pairs of amino acids:...

Question

Question

Hydrophobic interactions may occur between the R-groups of which of the following pairs of amino acids:...

Hydrophobic interactions may occur between the R-groups of which of the following pairs of amino acids:

A. Arg and His

B. His and Asp

C. Tyr and Gly

D. Phe and Trp

E. Val and Asn

science biology

Add a comment Improve this question Transcribed image text

Answer 1

Answer #1

07 Phe and Tre

Add a comment

Answer 2

Similar Homework Help Questions

Which amino acids comprise the binding site for PGE A 601?

For 4F5S in RCSB PDB websiteWhich amino acids comprise the binding site for PGE A 601? Select all that apply ValAspTrplleSerGlyPheHisProLeuLysCysAlaAsnMetTyrThreGurArgGin
Below are pairs of amino acids that interact with each other via their R groups to maintain protein structure. Which...

Below are pairs of amino acids that interact with each other via their R groups to maintain protein structure. Which will experience a change in their R-group interaction (eithera gain, loss or change specific type of interaction) when placed in a basic (pH 10) environment? (Select any/all that apply) Val, Ala GIn, Ser Asn, Cys Asp, Arg 1 nts Below are pairs of amino acids that interact with each other via their R groups to maintain protein structure. Which will...
Which of these protein sequences is most likely to span a cell membrane? Gly-Asp-Val-Ala-Gly-Arg-Gly-Asn-Gly-Lys-Lys-Pro-Ser-Ser-Val-Arg-Ala-Leu-Ser Ile-Val-Leu-Pro-Ile-Val-Leu-Leu-Val-Phe-Leu-Cys-Leu-Gly-Val-Phe-Leu-Leu-Trp Lys-Asn-Trp-Arg-Leu-Lys-Asn-I

Which of these protein sequences is most likely to span a cell membrane? Gly-Asp-Val-Ala-Gly-Arg-Gly-Asn-Gly-Lys-Lys-Pro-Ser-Ser-Val-Arg-Ala-Leu-Ser Ile-Val-Leu-Pro-Ile-Val-Leu-Leu-Val-Phe-Leu-Cys-Leu-Gly-Val-Phe-Leu-Leu-Trp Lys-Asn-Trp-Arg-Leu-Lys-Asn-Ile-Asn-ser-Ile-Asn-Phe-Asp-Asn-Pro-Val-Tyr-Gln A. 773 B. 792 C. 811

1. which tripeptide will most likely line the opening of a Cl- channel? a. His-Lys-Arg b....

1. which tripeptide will most likely line the opening of a Cl- channel? a. His-Lys-Arg b. Gly-Pro-Arg c. Asp-Trp-Tyr d. Asp-Ala-Glu e. Leu-Val-Phe 2. Which tripeptide will most likely line the opening of a K+ channel? (consider side chains at physiological pH) a. His-Lys-Arg b. Gly-Pro-Arg c. Asp-Trp-Tyr d. Asp-Ala-Glu e. Leu-Val-Phe
repulsion within the protein 10. Which of the following amino acids do not contain a chiral...

repulsion within the protein 10. Which of the following amino acids do not contain a chiral carbon? a. Proline b. Alanine c. Glycine d. Phenylalanine e. Tyrosine 11. You want to determine an amino acid sequence for a particular polypeptide. So you degrade the peptid and get the following fragments. Determine the peptide sequence. Digested with typsin: Met-Val-Ser-Thr-Lys Val-lle-Trp-Thr-Leu-Met-lle Leu-Phe-Asn-Glu-Ser-Arg Digested with chymotrypsin: Asn-Glu-Ser-Arg-Val-lle-Trp Thr-Leu-Met-lle Met-Val-Ser-Thr-Lys-Leu-Phe a. Val-lle-Trp-Thr-Leu-Met-lle-Leu-Phe-Asn-Glu-Ser-Arg-Met-Val-Ser-Thr-Lys b. Val-lle-Trp-Thr-Leu-Met-lle-Met-Val-Ser-Thr-Lys-Leu-Phe-Asn-Glu-Ser-Arg c. Leu-Phe-Asn-Glu-Ser-Arg-Met-Val-Ser-Thr-Lys-Val-lle-Trp-Thr-Leu-Met-le d. Met-Val-Ser-Thr-Lys-Leu-Phe-Asn-Glu-Ser-Arg-Val-le-Trp-Thr-Leu-Met-lle e. Met-Val-Ser-Thr-Lys-Val-lle-Trp-Thr-Leu-Met-lle-Leu-Phe-Asn-Glu-Ser-Arg
3. A protein contains the following amino acids: O ALA 4 GLN 1 LEU 3 ARG...

3. A protein contains the following amino acids: O ALA 4 GLN 1 LEU 3 ARG 4 GLU 4 LYS 4 ASN 5 GLY O MET 1 ASP 1 HIS 2 PHE 4 ILE 4 PRO 8 SER 5 THR 1 TRP 2 TYR 2 VAL BGYS. a) What is its net charge at pH 1? b) What is its net charge at PH 13? c) Calculate the pl. 4. In what order would the amino acids GLU, LYS, and...

Need help with #2 Clearly provide the 3-letter symbol for the correct sequence of cach amino...

Need help with #2 Clearly provide the 3-letter symbol for the correct sequence of cach amino acid in each of listings of the amino acids in the peptide or in any fragments are simply listed in alphabetical order. A subscriptive the number of that amino acid. Use parentheses to incorporate the unknown amino acids after each treatment 1. A five amino acid peptide contains: Arg. Glu, His, Phe, and Ser This peptide yields the following results when broken down into...
On your internship, you visit the Mass Spectrometry Lab. Mass spectrometry can identify short peptide fragments...

On your internship, you visit the Mass Spectrometry Lab. Mass spectrometry can identify short peptide fragments based on their molecular weights. Your fellow intern Jerry has neglected to label his tubes of amyloid beta peptide 42 after digesting them with some proteases that we learned about in Module 6: pepsin, trypsin, and chymotrypsin. Help him figure out what protease is in each tube. Jerry’s supervisor has the fragments listed in the same order as the original peptide primary sequence, which...
For the following DNA strand, what is the amino acid chain that would result in the cell?

For the following DNA strand, what is the amino acid chain that would result in the cell? CGGTTATCTAAAGTACACTATCATGGC Arg - leu - ser-lys - val - his - tyr-his-gly Ala - asn- - arg - phe - his - val - ile - val - pro met - ile -val - tyr - phe - arg Ala-met-ile-val-tyr - phe - arg - pro

5. Consider the following peptide: His-Ser-Gln-Gly-Thr-Phe-Thr-Ser-Asp-Tyr-Ser-Lys-Tyr-Leu-Asp-Ser-Arg-Arg-Ala-Gin- Asp-Phe-Val-Gln-Trp-Leu-Met-Asn-Thr a. What are the fragments, if it is cleaved...

5. Consider the following peptide: His-Ser-Gln-Gly-Thr-Phe-Thr-Ser-Asp-Tyr-Ser-Lys-Tyr-Leu-Asp-Ser-Arg-Arg-Ala-Gin- Asp-Phe-Val-Gln-Trp-Leu-Met-Asn-Thr a. What are the fragments, if it is cleaved by trypsin? b. What are the fragments, if it is cleaved by chymotrypsin? c. What are the fragments, if it is cleaved by pepsin?

Hydrophobic interactions may occur between the R-groups of which of the following pairs of amino acids:...

Homework Answers

Add Answer to:
Hydrophobic interactions may occur between the R-groups of which of the following pairs of amino acids:...

Post as a guest

Earn Coins

Which amino acids comprise the binding site for PGE A 601?

Below are pairs of amino acids that interact with each other via their R groups to maintain protein structure. Which...

Which of these protein sequences is most likely to span a cell membrane? Gly-Asp-Val-Ala-Gly-Arg-Gly-Asn-Gly-Lys-Lys-Pro-Ser-Ser-Val-Arg-Ala-Leu-Ser Ile-Val-Leu-Pro-Ile-Val-Leu-Leu-Val-Phe-Leu-Cys-Leu-Gly-Val-Phe-Leu-Leu-Trp Lys-Asn-Trp-Arg-Leu-Lys-Asn-I

1. which tripeptide will most likely line the opening of a Cl- channel? a. His-Lys-Arg b....

repulsion within the protein 10. Which of the following amino acids do not contain a chiral...

3. A protein contains the following amino acids: O ALA 4 GLN 1 LEU 3 ARG...

Need help with #2 Clearly provide the 3-letter symbol for the correct sequence of cach amino...

On your internship, you visit the Mass Spectrometry Lab. Mass spectrometry can identify short peptide fragments...

For the following DNA strand, what is the amino acid chain that would result in the cell?

5. Consider the following peptide: His-Ser-Gln-Gly-Thr-Phe-Thr-Ser-Asp-Tyr-Ser-Lys-Tyr-Leu-Asp-Ser-Arg-Arg-Ala-Gin- Asp-Phe-Val-Gln-Trp-Leu-Met-Asn-Thr a. What are the fragments, if it is cleaved...

Hydrophobic interactions may occur between the R-groups of which of the following pairs of amino acids:...

Homework Answers

Add Answer to: Hydrophobic interactions may occur between the R-groups of which of the following pairs of amino acids:...

Post as a guest

Earn Coins

Add Answer to:
Hydrophobic interactions may occur between the R-groups of which of the following pairs of amino acids:...