We need at least 10 more requests to produce the answer.
0 / 10 have requested this problem solution
The more requests, the faster the answer.
Question 2 Select the statement below that BEST describes the synthesis of cDNA. mRNA is used...
Which statement best describes restriction enzymes? View Available Hint(s) Which statement best describes restriction enzymes? They randomly cut DNA molecules to generate numerous fragments. They are necessary for the polymerase chain reaction (PCR) to occur. They are important for cloning applications because they can be used to cut DNA at specific nucleotide sequences. They can cut only circular plasmid DNA.
find the errors Restriction enzymes recognize specific DNA sequences and cut each strand of DNA at specific locations at the target sequence. The result of digesting a particular genome with a particular restriction enzyme is a collection of restriction fragments of defined length and composition. These can be used to generate restriction maps or create pieces with sticky ends. These sticky ends can be used to attach to other fragments that have sticky ends caused by cutting with a different...
I didnt do quite as well as i wpuld have liked on my molecular bio exam. Please help me reciew what I missed. Thanks! We were unable to transcribe this imageWe were unable to transcribe this imageA fragment restricted with EcoRI enzyme can be used for ligation into a plasmid that was restricted with BamHI because both the insert and the plasmid contain sticky ends a True b) False 10. Polynucleotide probes can be used to screen a genomic library...
A plasmid used as a cloning vector in E. coli must have… Does sequence similarity between genes play an important role in assigning gene function? Successful insertion of a DNA fragment into the multi-cloning region (restriction sites) of a recombinant plasmid is detected by what changes? Understand the concept of (restriction enzyme produced) DNA fragment separation by gel electrophoresis. In addition to restriction enzymes, which enzyme(s) are required to insert a fragment of DNA into a cloning vector? What is...
1.When cloning a PCR product into a plasmid using restriction enzymes, the restriction enzyme recognition sequences in the PCR product most likely came from _______, and the restriction enzyme recognition sequences in the plasmid most likely came from ________. a. A multiple cloning site / the primers b. The primers / a multiple cloning site c. Both came from primers d. Both came from the multiple cloning site e. Naturally present in the gene of interest / the multiple cloning...
15- Which option BEST describes sticky ends by restriction enzymes B. Sticky ends A. Sticky ends are DNA fragments that carry a higher charge than normal after they have been cleaved are DNA fragments cleaved by a restriction enzyme so that one strand is longer than the other C. Sticky ends are DNA fragments cleaved by a restriction enzyme so that both strands are the same length. D. Sticky ends are DNA fragments that attract a carbohydrate molecule to one...
24. What would be the anticodon if the template strand of DNA Is ACC A UCC B.) TGG UGG D. ACC E. TCC 25. Prior to protein synthesis, the DNA A. attracts tRNAs with appropriate amino acids. 6.) serves as a template for the production of mRNA. C. adheres to ribosomes for protein synthesis. D. contains anticodons that become codons. E. must first undergo replication. 26. The Human Genome Project has revealed that human DNA has approximately A. 30,000 bases...
Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains a start codon and could serve as the template for synthesis of an mRNA molecule. 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) a. Which strand will serve as the template strand for transcription? b. Based on the template strand you have chosen, write the mature mRNA sequence on your answer sheet in the 5’ to 3’ direction. Be sure to label 5’ and...
What role does mRNA play in the process of protein synthesis? Choose all that apply. Select one or more: Every three nucleotides binds an amino acid It opens up the DNA strand for transcription to occur ] c. It is a template for the arrangement of tRNAS 1 d. It determines the order in which amino acids are added to the growing protein e. It copies DNA to be used in later steps
Question 2 1 pts A sequence of DNA that contains information for the synthesis of RNA molecules used in the manufacture of proteins is also known as a(n) intron. mutation. gene. codon. Flag this Question Question 3 1 pts A small segment of DNA on the template strand contains the base sequence CGT. If an mRNA transcript is made that includes this sequence, what would be the anticodon on the tRNA that would bind to this corresponding mRNA sequence? CGT...