2.Base changes in which of the following can have evolutionary sequences? -Non-coding RNA -mRNA -Promoter sequences...
2.Base changes in which of the following can have evolutionary sequences?
-Non-coding RNA
-mRNA
-Promoter sequences
-Protein coding gene
-Cis-regulatory module
Homework Answers
Answer:-
Base changes in the m-RNA and Protein coding gene can have evolutionary sequences.
Because the genes are the units of heridity although the whole genome is being replicated to prevent the genome size but we have only few 30000 genes in comparison to large genome size all other genes are not expressed . Therefore, the part of of genome which is funtional is being expressed and that is necessary for life and that part of the genome will tell us about the evolutionary relationship, while the promoter sequences and cis-regulatory sequnces are there for enhancing the rate of trancription they didn't tell us about the evolutionary sequences. And also the non coding m-rna will also not tell us anything about the evolutionary sequences.
Add Answer to:
2.Base changes in which of the following can have evolutionary
sequences?
-Non-coding RNA
-mRNA
-Promoter sequences...
son Label the diagram below (A-Protein coding region B-Regulatory switches C-Promoter D. mRNA e. RNA polymerase)...
son Label the diagram below (A-Protein coding region B-Regulatory switches C-Promoter D. mRNA e. RNA polymerase) (2) f. Assume that a fish inherits a deletion mutation in the pituitary switch such that the switch becomes inactive. You isolate DNA from jaw, pelvic, eye, and pituitary tissues. In the DNA of which tissue(s) would you expect the pituitary switch mutation? (2)
(2pts) Which of the following statements does NOT accurately describe enhancer sequences: A. Enhancer sequences can...
(2pts) Which of the following statements does NOT accurately describe enhancer sequences: A. Enhancer sequences can be located far away from the promoter that it regulates B. Enhancer sequences are cis-acting regulatory elements C. Enhancer sequences can be located either upstream (5’) or downstream (3’) the gene D.Enhancer sequences are located within 10 to 35 base pairs upstream of the promoter When bound by transcription factors, enhancer sequences enhance gene expression
Question 2: Transcription, RNA Processing and Translation A particular gene codes for a mature mRNA transcript...
Question 2: Transcription, RNA Processing and Translation A particular gene codes for a mature mRNA transcript containing 1200 bases, which is translated into a protein containing 300 amino acids. A. How long is the coding sequence in this mRNA and how many nucleotides are in the UTRs? For the purposes of this question we are ignoring the G’ cap and the polyA tail. B. A mutant form of the gene created by one nucleotide being changed to another nucleotide also...
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary...
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...
Can someone please help me answer these questions. Thank you! Eukaryotic transcription signals a) This drawing shows the placements of the four main sequences of the eukaryotic core promoter for RNA...
Can someone please help me answer these questions. Thank
you!
Eukaryotic transcription signals
a) This drawing shows the placements of the four main sequences of
the eukaryotic core promoter for RNA polymerase II. Identify each
one and give a brief explanation
b) Which sequences are used in a DPE-driven promoter?
c) Which ones are used in a TATA-driven promoter?
d) Please draw and describe the steps as the transcription factors
work with eukaryotic RNA polymerase II to start transcription of...
1. Which of the following statements concerning transcription of bacterial mRNA is not true? Bacterial mRNA...
1. Which of the following statements concerning transcription of bacterial mRNA is not true? Bacterial mRNA must have intron material removed before it can be used in the process of protein translation.* Energy necessary for transcription is provided by the breaking of phosphate bonds carried by ribonucleotide triphosphates (rNTPs). A sigma factor recognizes the promoter site sequences on the DNA strand during transcription. A guanine-rich sequence on the template DNA molecule causes the growing RNA strand to loop and detach.
Central Dogma and the Spider Silk Goats Introducing DNA Sequences called Promoters So why is the...
Central Dogma and the Spider Silk Goats Introducing DNA Sequences called Promoters So why is the spider sillk protein ONLY made in A PROMOTER is a non-coding DNA the mammary tissues ofsequence that controls the goat?!?!?! when and where a gene is turned on" (transcribed)! We know enough about promoters that we can engineer where a particular gene is expressed (switched on) and its protein is made. Promoter Transcription unit 3' DNA Start point RNA polymerase We were unable to...
hello, two of these circled answers are incorrect. 1 6. The promoter sequences are the positions...
hello, two of these circled answers are incorrect.
1 6. The promoter sequences are the positions that: signal the initiation site of a gene (+1) B) bind the transcriptional factor that is associated with RNA polymerase e) attach the correct nucleotide triphosphate to the template DNA strand D) separate the two DNA strands CUA 7. A particular triplet of bases in the coding sequence of DNA is GAT. The anticodon on the tRNA that binds the mRNA codon is A...
Answer the questions: Question 11 Recognition/binding site of RNA polymerase is called a Receptorb. Promoter ....
Answer the questions:
Question 11 Recognition/binding site of RNA polymerase is called a Receptorb. Promoter . Facilitatord. Terminator Question 12 .A specific factor helps RNA polymerase binding to promoters and transcribe genes a Delta b. Beta Gamma d. Sigma Question 13 ............ Promoters lack a TATA box are referred to as TATA less promoters, for example operon Housekeeping genes b. Functional genesc d. Structural genes Question 14 0.5 points Save Answer During "RNA processing" All of the exons are a....
An RNA molecule has the following sequence: ’UCAAUGCUUAAGAAGGCAUGAAAUAA 3’ Label the protein-coding region of this mRNA,...
An RNA molecule has the following sequence: ’UCAAUGCUUAAGAAGGCAUGAAAUAA 3’ Label the protein-coding region of this mRNA, and any other region(s) that are present. What is the sequence of the polypeptide it codes for?
son Label the diagram below (A-Protein coding region B-Regulatory switches C-Promoter D. mRNA e. RNA polymerase) (2) f. Assume that a fish inherits a deletion mutation in the pituitary switch such that the switch becomes inactive. You isolate DNA from jaw, pelvic, eye, and pituitary tissues. In the DNA of which tissue(s) would you expect the pituitary switch mutation? (2)
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...
Can someone please help me answer these questions. Thank
you!
Eukaryotic transcription signals
a) This drawing shows the placements of the four main sequences of
the eukaryotic core promoter for RNA polymerase II. Identify each
one and give a brief explanation
b) Which sequences are used in a DPE-driven promoter?
c) Which ones are used in a TATA-driven promoter?
d) Please draw and describe the steps as the transcription factors
work with eukaryotic RNA polymerase II to start transcription of...
1. Which of the following statements concerning transcription of bacterial mRNA is not true? Bacterial mRNA must have intron material removed before it can be used in the process of protein translation.* Energy necessary for transcription is provided by the breaking of phosphate bonds carried by ribonucleotide triphosphates (rNTPs). A sigma factor recognizes the promoter site sequences on the DNA strand during transcription. A guanine-rich sequence on the template DNA molecule causes the growing RNA strand to loop and detach.
Central Dogma and the Spider Silk Goats Introducing DNA Sequences called Promoters So why is the spider sillk protein ONLY made in A PROMOTER is a non-coding DNA the mammary tissues ofsequence that controls the goat?!?!?! when and where a gene is turned on" (transcribed)! We know enough about promoters that we can engineer where a particular gene is expressed (switched on) and its protein is made. Promoter Transcription unit 3' DNA Start point RNA polymerase We were unable to...
hello, two of these circled answers are incorrect.
1 6. The promoter sequences are the positions that: signal the initiation site of a gene (+1) B) bind the transcriptional factor that is associated with RNA polymerase e) attach the correct nucleotide triphosphate to the template DNA strand D) separate the two DNA strands CUA 7. A particular triplet of bases in the coding sequence of DNA is GAT. The anticodon on the tRNA that binds the mRNA codon is A...
Answer the questions:
Question 11 Recognition/binding site of RNA polymerase is called a Receptorb. Promoter . Facilitatord. Terminator Question 12 .A specific factor helps RNA polymerase binding to promoters and transcribe genes a Delta b. Beta Gamma d. Sigma Question 13 ............ Promoters lack a TATA box are referred to as TATA less promoters, for example operon Housekeeping genes b. Functional genesc d. Structural genes Question 14 0.5 points Save Answer During "RNA processing" All of the exons are a....
Most questions answered within 3 hours.
-
Which of the following pairs of ions have the same electron
configuration?
I: Br− and Se2−...
asked 1 hour ago -
The Foremost Composite Materials Company is planning a two-day
sales conference for October 19-20. The conference...
asked 1 hour ago -
3) Illustrate the observed pattern of relatedness of organisms
versus adaptations to specific conditions. This means...
asked 1 hour ago -
In winter a lake has a 0.35 m thick ice layer over 1.10 m of
water....
asked 2 hours ago -
Assuming the following has been encrypted with a Vigenere cipher
below, use the method(s) and assumptions...
asked 3 hours ago -
How would I use switch statements to write a program that will
take an input of...
asked 3 hours ago -
Imagine a reaction in which methane gas combusts at a constant
pressure of 1 atm and...
asked 3 hours ago -
Two parallel wires (each 12 m in length) are separated by a
distance of 0.065 m...
asked 3 hours ago -
Suppose there were three masses at the corner of uniform
equilateral triangle. The masses are m1...
asked 3 hours ago -
Situation: A building that is 618 m above the ground floor. How
many times would a...
asked 3 hours ago -
help me and discuss one successful and one
unsuccessful international company/busines in Indonesia.whyit
succeed and why...
asked 3 hours ago -
I- Choose the best answer
Which of the following statements about the structure and
packaging of...
asked 3 hours ago