Indicate which of the amino acid residues in the following peptide sequence contains a group that...
Indicate which of the amino acid residues in the following peptide sequence contains a group that has a negative charge for its most likely charge state at pH 10.
Phe-Val-Pro-His-Trp-Asn-Cys-Thr-Asp
Please explain in detail how you got the answer. thank you!
Homework Answers
Add Answer to:
Indicate which of the amino acid residues in the following
peptide sequence contains a group that...
Indicate which of the amino acid residues in the following peptide sequence contains a group that...
Indicate which of the amino acid residues in the following peptide sequence contains a group that has a negative charge for its most likely charge state at pH 10. Glu-Cys-Tyr-Lys-Asp-Ile-Leu-His-Trp
28. What is the amino acid sequence that will be produced from this original DNA sequence:...
28. What is the amino acid sequence that will be produced from this original DNA sequence: 3' GCATGTACACCTTGGCGACGACTGCTTA 5' a. Met - Tyr - Asn - Thr - Leu - Ala - Thr-Thr - Ala b. Met - Trp -Asn-Arg - Cys C. Ala-Lys - Thr-Pro-Gly - Asp - Asp - Cys d. Arg - Thr-Cys - Gly-Pro-Leu-Leu - Thr - Asn e. None of the above Using the original DNA OG the new mutat
Based on the chemical properties of the residues, which of the following sequences could form the...
Based on the chemical properties of the residues, which of the
following sequences could form the following? At least one should
be placed in each category.
Based on the chemical properties of the residues, which of the following sequences could form the following? At least one should be placed in each category Most likely an amphipathic Most likely an amphipathic B sheet a helix Most likely a turn/ loop Not amphipathic Asn-Leu-Ala-Asp-Ser-Phe-Arg-Gin-lle Lys-Ser-Thr-Asn-Glu-Gin-Asn-Ser-Arg Gin-lle-Thr-Phe-Thr-Leu-GIn-Val-Ser Lys-GIn-Asn-Glu-Pro-Arg-Ala-Asn-Glu Arg-Phe-GIn-lle-His-Val-Gin-Phe-Glu Ala-Phe-Leu-Val-lle-Trp-Phe-Val-Ala
The next DNA sequence is the MATRICE strand of a small gene. What is the complete...
The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...
PLEASE HELP OCHEM QUESTION 1. In the following protein, identify the type of bonding or interaction...
PLEASE HELP OCHEM QUESTION
1. In the following protein, identify the type of bonding or interaction that is responsible for holding the two peptide chains together at each amino acid pair, above (A) and below (B). Gly - Ala - Ser - Cys - Val - Asp - Leu - Thr - His - Ile-Tyr-Glu - Phe - Lys - Cys - Met - Asn Val - Leu -Gin-Cys - Pro-Lys - Met - Tyr - Asp -Phe-Asn-Lys - Ile...
repulsion within the protein 10. Which of the following amino acids do not contain a chiral...
repulsion within the protein 10. Which of the following amino acids do not contain a chiral carbon? a. Proline b. Alanine c. Glycine d. Phenylalanine e. Tyrosine 11. You want to determine an amino acid sequence for a particular polypeptide. So you degrade the peptid and get the following fragments. Determine the peptide sequence. Digested with typsin: Met-Val-Ser-Thr-Lys Val-lle-Trp-Thr-Leu-Met-lle Leu-Phe-Asn-Glu-Ser-Arg Digested with chymotrypsin: Asn-Glu-Ser-Arg-Val-lle-Trp Thr-Leu-Met-lle Met-Val-Ser-Thr-Lys-Leu-Phe a. Val-lle-Trp-Thr-Leu-Met-lle-Leu-Phe-Asn-Glu-Ser-Arg-Met-Val-Ser-Thr-Lys b. Val-lle-Trp-Thr-Leu-Met-lle-Met-Val-Ser-Thr-Lys-Leu-Phe-Asn-Glu-Ser-Arg c. Leu-Phe-Asn-Glu-Ser-Arg-Met-Val-Ser-Thr-Lys-Val-lle-Trp-Thr-Leu-Met-le d. Met-Val-Ser-Thr-Lys-Leu-Phe-Asn-Glu-Ser-Arg-Val-le-Trp-Thr-Leu-Met-lle e. Met-Val-Ser-Thr-Lys-Val-lle-Trp-Thr-Leu-Met-lle-Leu-Phe-Asn-Glu-Ser-Arg
Be sure to answer all parts. Give the amino acid sequence of an octapeptide that contains the ami...
Please help!
Be sure to answer all parts. Give the amino acid sequence of an octapeptide that contains the amino acids Pro, Asp, Gln (2 equiv), Leu, Thr, Cys, Glu, and forms the following fragments when partially hydrolyzed with HCI: Pro-Gln-Cys, Asp-Thr-Leu-Glu, and Cys-Gln-Asp-Thr.
Be sure to answer all parts. Give the amino acid sequence of an octapeptide that contains the amino acids Pro, Asp, Gln (2 equiv), Leu, Thr, Cys, Glu, and forms the following fragments when partially hydrolyzed...
I 79) The sequence of a nonapeptide was determined from the following evidence: a. A peptide...
I 79) The sequence of a nonapeptide was determined from the following evidence: a. A peptide is acyclic compound containing a disulfide bridge between two cysteine residues. b. When the disulfide bridge is reduced, peptide has the constitution Asn, Cys2, Gin, Gly, Ile, Leu, Pro, Tyr. Partial hydrolysis of reduced peptide yields seven fragments: Asp-Cys, Ile-Glu, Cys-Tyr, Leu-Gly, Tyr-Ile-Glu, Glu-Asp-Cys, and Cys-Pro-Leu. d. Gly is the C-terminal group. C W What is the amino acid sequence of reduced peptide? What...
This sequence is RNA because:
20. This sequence is RNA because:A) it is single stranded.B) it contains U (uracil) and no T (thymine).C) it runs in a 5' to 3' direction.D) it codes for amino acids.E) it is a small molecule.21. Which amino acids does this sequence code for, if the reading frame is as shown, starting from the correct end? A) gly-ala-arg-cys-ile...B) pro-arg-ala-thr-stopC) met-asn-glu-leu...D) glu-leu-val-val-phe...E) leu-glu-gln-his-asn...22. If the sequence gets changed to 5' ... GGAGACUCGUUGUAUU... 3'. What would be the effect on the amino...
please explain how to solve this problem, the answer is provided 9. Peptides: (20 pts.). A...
please explain how to solve this problem, the answer
is provided
9. Peptides: (20 pts.). A polypeptide (X) gives 7 fragments when treated with chymotrypsin (A-G). The same peptide also gives 9 fragments when treated with trypsin (I- IX). After Chymotrypsin A) Thr-Thr-Tyr-Ala-Gly-Phe-Phe-Ile-Asp- Lys B) Ala-Cys-Pro-Leu-Tyr-Gin-lle-Arg C) Met-Ser-Thr-Tyr-Pro-Gly-Arg D) Cys-Leu-Val-Phe-Ile-Lys E) Leu-Ala-Trp-Gly-Val F) Ser-Phe-Ala-Pro-Lys G) Met-Asp-Lys Afier Trypsin I) Ala-Pro-Lys-Met-Asp-Lys-Thr-Thr-Tyr II) Pro-Gly-Arg-Cys-Leu-Val-Phe III) Ile-Lys-Ala-Cys-Pro-Leu-Tyr IV) Ile-Asp-Lys-Met-Ser-Thr-Tyr V) Gin-Ile-Arg-Leu-Ala-Trp VIAla-Gly-Phe VII) Gly-Val VIII) Ser-Phe LX) Phe A) What is the primary...
28. What is the amino acid sequence that will be produced from this original DNA sequence: 3' GCATGTACACCTTGGCGACGACTGCTTA 5' a. Met - Tyr - Asn - Thr - Leu - Ala - Thr-Thr - Ala b. Met - Trp -Asn-Arg - Cys C. Ala-Lys - Thr-Pro-Gly - Asp - Asp - Cys d. Arg - Thr-Cys - Gly-Pro-Leu-Leu - Thr - Asn e. None of the above Using the original DNA OG the new mutat
Based on the chemical properties of the residues, which of the
following sequences could form the following? At least one should
be placed in each category.
Based on the chemical properties of the residues, which of the following sequences could form the following? At least one should be placed in each category Most likely an amphipathic Most likely an amphipathic B sheet a helix Most likely a turn/ loop Not amphipathic Asn-Leu-Ala-Asp-Ser-Phe-Arg-Gin-lle Lys-Ser-Thr-Asn-Glu-Gin-Asn-Ser-Arg Gin-lle-Thr-Phe-Thr-Leu-GIn-Val-Ser Lys-GIn-Asn-Glu-Pro-Arg-Ala-Asn-Glu Arg-Phe-GIn-lle-His-Val-Gin-Phe-Glu Ala-Phe-Leu-Val-lle-Trp-Phe-Val-Ala
The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...
PLEASE HELP OCHEM QUESTION
1. In the following protein, identify the type of bonding or interaction that is responsible for holding the two peptide chains together at each amino acid pair, above (A) and below (B). Gly - Ala - Ser - Cys - Val - Asp - Leu - Thr - His - Ile-Tyr-Glu - Phe - Lys - Cys - Met - Asn Val - Leu -Gin-Cys - Pro-Lys - Met - Tyr - Asp -Phe-Asn-Lys - Ile...
repulsion within the protein 10. Which of the following amino acids do not contain a chiral carbon? a. Proline b. Alanine c. Glycine d. Phenylalanine e. Tyrosine 11. You want to determine an amino acid sequence for a particular polypeptide. So you degrade the peptid and get the following fragments. Determine the peptide sequence. Digested with typsin: Met-Val-Ser-Thr-Lys Val-lle-Trp-Thr-Leu-Met-lle Leu-Phe-Asn-Glu-Ser-Arg Digested with chymotrypsin: Asn-Glu-Ser-Arg-Val-lle-Trp Thr-Leu-Met-lle Met-Val-Ser-Thr-Lys-Leu-Phe a. Val-lle-Trp-Thr-Leu-Met-lle-Leu-Phe-Asn-Glu-Ser-Arg-Met-Val-Ser-Thr-Lys b. Val-lle-Trp-Thr-Leu-Met-lle-Met-Val-Ser-Thr-Lys-Leu-Phe-Asn-Glu-Ser-Arg c. Leu-Phe-Asn-Glu-Ser-Arg-Met-Val-Ser-Thr-Lys-Val-lle-Trp-Thr-Leu-Met-le d. Met-Val-Ser-Thr-Lys-Leu-Phe-Asn-Glu-Ser-Arg-Val-le-Trp-Thr-Leu-Met-lle e. Met-Val-Ser-Thr-Lys-Val-lle-Trp-Thr-Leu-Met-lle-Leu-Phe-Asn-Glu-Ser-Arg
Please help!
Be sure to answer all parts. Give the amino acid sequence of an octapeptide that contains the amino acids Pro, Asp, Gln (2 equiv), Leu, Thr, Cys, Glu, and forms the following fragments when partially hydrolyzed with HCI: Pro-Gln-Cys, Asp-Thr-Leu-Glu, and Cys-Gln-Asp-Thr.
Be sure to answer all parts. Give the amino acid sequence of an octapeptide that contains the amino acids Pro, Asp, Gln (2 equiv), Leu, Thr, Cys, Glu, and forms the following fragments when partially hydrolyzed...
I 79) The sequence of a nonapeptide was determined from the following evidence: a. A peptide is acyclic compound containing a disulfide bridge between two cysteine residues. b. When the disulfide bridge is reduced, peptide has the constitution Asn, Cys2, Gin, Gly, Ile, Leu, Pro, Tyr. Partial hydrolysis of reduced peptide yields seven fragments: Asp-Cys, Ile-Glu, Cys-Tyr, Leu-Gly, Tyr-Ile-Glu, Glu-Asp-Cys, and Cys-Pro-Leu. d. Gly is the C-terminal group. C W What is the amino acid sequence of reduced peptide? What...
please explain how to solve this problem, the answer
is provided
9. Peptides: (20 pts.). A polypeptide (X) gives 7 fragments when treated with chymotrypsin (A-G). The same peptide also gives 9 fragments when treated with trypsin (I- IX). After Chymotrypsin A) Thr-Thr-Tyr-Ala-Gly-Phe-Phe-Ile-Asp- Lys B) Ala-Cys-Pro-Leu-Tyr-Gin-lle-Arg C) Met-Ser-Thr-Tyr-Pro-Gly-Arg D) Cys-Leu-Val-Phe-Ile-Lys E) Leu-Ala-Trp-Gly-Val F) Ser-Phe-Ala-Pro-Lys G) Met-Asp-Lys Afier Trypsin I) Ala-Pro-Lys-Met-Asp-Lys-Thr-Thr-Tyr II) Pro-Gly-Arg-Cys-Leu-Val-Phe III) Ile-Lys-Ala-Cys-Pro-Leu-Tyr IV) Ile-Asp-Lys-Met-Ser-Thr-Tyr V) Gin-Ile-Arg-Leu-Ala-Trp VIAla-Gly-Phe VII) Gly-Val VIII) Ser-Phe LX) Phe A) What is the primary...
Most questions answered within 3 hours.
-
1.
Today Tomorrow
Price of Coke 1.90 2.10
Quantity of Pepsi 297 303
a. Write down...
asked 56 minutes ago -
Fluorine-20 has a half-life of 11.0 s. If a sample initially
contains 36.0 μg of this...
asked 1 hour ago -
How many fissions take place per second in a 190-MW reactor?
Assume 200 MeV is released...
asked 2 hours ago -
IQ scores are normally distributed with a mean of 100 and a
standard deviation of 15....
asked 2 hours ago -
You are to assess the biomechanics of a male’s arm using his
bicep to hold a...
asked 4 hours ago -
What is the maximum number of grams of N-acetyl-p-toluidine can
be prepared from 70. milliliters of...
asked 5 hours ago -
A researcher is using a two-tailed hypothesis test with α =
.05 to evaluate the effect...
asked 7 hours ago -
Two long, straight wires are parallel and 8.5 cm apart. The top
wire carries a current...
asked 8 hours ago -
Three arguments used to promote trade barriers are the national
security argument, the infant-industry argument, and...
asked 9 hours ago -
Question 3:
Percentage of Completion
Method (12 marks) On January 1, 2017, Eagle Construction Ltd.
started...
asked 9 hours ago -
A company purchased a tract of land for its natural resources at
a cost of $2,042,900....
asked 9 hours ago -
1. These financial statement item are
for UPS Company at fiscal year-end, October 31, 2019.
...
asked 9 hours ago