a. If you knew the amino acid sequence of a peptide could you use that information...
a. If you knew the amino acid sequence of a peptide could you use that information to find the gene in a pool of genomic DNA. If so, how might you do this.
b. How does a cell recognize which strand is the sense strand? How does the RNA polymerase enzyme actually know where to start making a message. How about stopping?
(Detailed explanation please)
Homework Answers
ANS)
a)
--> The amino corrosive coded can tell the three base which together structure codon on mRNA to code for that specific amino corrosive. The mRNA succession would thus be able to help in realizing DNA arrangement by complementary to layout strand.
b)
-->The 3' end of layout strand have advertiser district which helps in acknowledgment of this site by RNA polymerase compound, the terminal region is available 5' downstream of format strand. The barrette GC and U is shaped in prokaryotes while in eukaryotes oligo arrangement polyadenylation and DNA restricting element are utilized for endonuclease action.
Add Answer to:
a. If you knew the amino acid sequence of a peptide could you
use that information...
1. Do all parts: a. The sequence of a gene on mRNA is normally AUGCCCGACUUU. The...
1. Do all parts: a. The sequence of a gene on mRNA is normally AUGCCCGACUUU. The point mutation in the gene results in the MRNA sequence AUGCCGGACUUU. What are the amino acid sequence for the normal and mutant proteins? Say, with an explanation whether you expect this to be a silent mutation. b. Why is DNA polymerase said to be template-directed? If a RNA had the nucleotide sequence 5'-AUGCCAUAACGAUACCCCAGUC-3', what was the sequence of the DNA strand that was transcribed...
15. Determine the amino acids following mRNA molecules. ne the amino acid sequence a ribosome would...
15. Determine the amino acids following mRNA molecules. ne the amino acid sequence a ribosome would translate from the *GCACCAUGCAAAGCGGGGAUUAGACCUUU-3 Caution: from which end of the RNA strand does the ribosome begin translating? 3-AGAGUCCAUGCAAAGCGGGGAUUGUACCUUU - 5' 16. Determine the amino acid sequence a ribosome would translate from the following non template DNA strand. (Hint: you must first convert the non template DNA strand to a template DNA strand and then to mRNAJ 3'-ACCTTGATCCTTGACGTATGTAGTATGTATC-5'
Unwinds DNA strand to make replication fork. Adds free nucleotides to the growing daughter DNA strands...
Unwinds DNA strand to make replication fork. Adds free nucleotides to the growing daughter DNA strands Adds short pieces of RNA to help DNA polymerase start Removes RNA and replaces with DNA Fuses or "glues" fragments of DNA together Proofreads or edits the DNA, checking for mistakes Given the following, DNA Sequence, what is the new daughter strand? (Did you label the 5' and 3' ends?) What is the name of the "fragments" of DNA on the lagging strand after...
based on the given graph how would these be answered? sa sequence from a sheep PCR...
based on the given graph how would these be answered?
sa sequence from a sheep PCR product. The template used was genomic DNA and the forward and se primers were designed to amplify partofthe priongene, which encodes the causative agentot scrapie. is black;Cisblue; Ais green: Tisred. The forward primerwasusedasasequencing primer. TheNattheten ow means that the computer can't decide which nucleotide is at that position in the sequence because there are two peaks (red=T and blue-C) that are the same height....
28 29 30 31 32 33 28. Genes found in segments of chromosome called heterochromatin would...
28
29
30
31
32
33
28. Genes found in segments of chromosome called heterochromatin would likely be expressed at high levels. expressed at low levels, or not at all. deleted before replication. maternally inherited only. none of these 29. (Use this representation to answer the following question.) DNA template strand 5 3' DNA complementary strand 3' 5' Using the double-stranded molecule above, in which direction does the RNA polymerase enzyme move? 3' → 5' along the template strand 5'...
You examine a bacterial gene that produces a small peptide. The DNA sequence is predi produce...
You examine a bacterial gene that produces a small peptide. The DNA sequence is predi produce the mRNA sequence indicated below (Questions 13-15). cted to 5- UCUUAGGAGGUAUCCAUGUCCGGUACUGCGAGAGGUAGUUAAGCC3 Shine-Dalgarno motif Site of insertion for question 14 13) Predict the amino acid sequence of the peptide produced from this mRNA (use the 3-letter abbreviation for amino acid names; e.g. ILE for isoleucine, ALA for alanine. Look it up online if you can't find it in one of your biology books). 14) What...
6.) Vitamin C is an essential dietary vitamin for us because we cannot make it in...
6.) Vitamin C is an essential dietary vitamin for us because we cannot make it in our own bodies, the way that most animals can. This is because an important gene was inactivated by mutation in one of our ancestors millions of years ago. But vitamin C is not a protein. How can there be a gene to code for a molecule that is not a protein? (You may have to look some things up to answer this.) 7.) RNA...
Transcription is the process of rewriting DNA. DNA molecules are made from 4 different nucleotides which...
Transcription is the process of rewriting DNA. DNA molecules are made from 4 different nucleotides which acts as building blocks. These building blocks are adenine, thymine, guanine and cytosine. When put together in different chemical combinations they become directions for the functions of the cell molecules which are primarily proteins. When a certain protein is needed, the RNA polymerase enzyme will find the gene for that particular protein and makes an RNA copy of it. DNA and RNA have similar...
i need help on the whole page! 24. What is the chemical group responsible for making...
i
need help on the whole page!
24. What is the chemical group responsible for making these amino acids acidic? 25. List the 3 amino acids that can be phosphorylated using single letter names 20. If you want to mutate Tyrosine (Y) to keep it from being negatively charged, but keep it as close keep it as close in shape as possible to tyrosine, which amino acid would you change it to Use the single letter name. being negatively charged...
Can anyone explain these answers step by step. Especially I do not know how to start...
Can anyone explain these answers step by step. Especially I do
not know how to start question 1 or two!!! Thank you!
Work with a partner to complete the following questions. 1. Fill in the bases of the complementary DNA strand. 3-TATAATTACGCTAGATCACCCACT5 2. Transcribe the mRNA sequence using the bottom (3 to 5) strand as the template. What is the name of the sequence upstream of the gene that the RNA polymerase binds to? 3. 4. What polypeptide sequence would...
1. Do all parts: a. The sequence of a gene on mRNA is normally AUGCCCGACUUU. The point mutation in the gene results in the MRNA sequence AUGCCGGACUUU. What are the amino acid sequence for the normal and mutant proteins? Say, with an explanation whether you expect this to be a silent mutation. b. Why is DNA polymerase said to be template-directed? If a RNA had the nucleotide sequence 5'-AUGCCAUAACGAUACCCCAGUC-3', what was the sequence of the DNA strand that was transcribed...
15. Determine the amino acids following mRNA molecules. ne the amino acid sequence a ribosome would translate from the *GCACCAUGCAAAGCGGGGAUUAGACCUUU-3 Caution: from which end of the RNA strand does the ribosome begin translating? 3-AGAGUCCAUGCAAAGCGGGGAUUGUACCUUU - 5' 16. Determine the amino acid sequence a ribosome would translate from the following non template DNA strand. (Hint: you must first convert the non template DNA strand to a template DNA strand and then to mRNAJ 3'-ACCTTGATCCTTGACGTATGTAGTATGTATC-5'
Unwinds DNA strand to make replication fork. Adds free nucleotides to the growing daughter DNA strands Adds short pieces of RNA to help DNA polymerase start Removes RNA and replaces with DNA Fuses or "glues" fragments of DNA together Proofreads or edits the DNA, checking for mistakes Given the following, DNA Sequence, what is the new daughter strand? (Did you label the 5' and 3' ends?) What is the name of the "fragments" of DNA on the lagging strand after...
based on the given graph how would these be answered?
sa sequence from a sheep PCR product. The template used was genomic DNA and the forward and se primers were designed to amplify partofthe priongene, which encodes the causative agentot scrapie. is black;Cisblue; Ais green: Tisred. The forward primerwasusedasasequencing primer. TheNattheten ow means that the computer can't decide which nucleotide is at that position in the sequence because there are two peaks (red=T and blue-C) that are the same height....
28
29
30
31
32
33
28. Genes found in segments of chromosome called heterochromatin would likely be expressed at high levels. expressed at low levels, or not at all. deleted before replication. maternally inherited only. none of these 29. (Use this representation to answer the following question.) DNA template strand 5 3' DNA complementary strand 3' 5' Using the double-stranded molecule above, in which direction does the RNA polymerase enzyme move? 3' → 5' along the template strand 5'...
You examine a bacterial gene that produces a small peptide. The DNA sequence is predi produce the mRNA sequence indicated below (Questions 13-15). cted to 5- UCUUAGGAGGUAUCCAUGUCCGGUACUGCGAGAGGUAGUUAAGCC3 Shine-Dalgarno motif Site of insertion for question 14 13) Predict the amino acid sequence of the peptide produced from this mRNA (use the 3-letter abbreviation for amino acid names; e.g. ILE for isoleucine, ALA for alanine. Look it up online if you can't find it in one of your biology books). 14) What...
6.) Vitamin C is an essential dietary vitamin for us because we cannot make it in our own bodies, the way that most animals can. This is because an important gene was inactivated by mutation in one of our ancestors millions of years ago. But vitamin C is not a protein. How can there be a gene to code for a molecule that is not a protein? (You may have to look some things up to answer this.) 7.) RNA...
i
need help on the whole page!
24. What is the chemical group responsible for making these amino acids acidic? 25. List the 3 amino acids that can be phosphorylated using single letter names 20. If you want to mutate Tyrosine (Y) to keep it from being negatively charged, but keep it as close keep it as close in shape as possible to tyrosine, which amino acid would you change it to Use the single letter name. being negatively charged...
Can anyone explain these answers step by step. Especially I do
not know how to start question 1 or two!!! Thank you!
Work with a partner to complete the following questions. 1. Fill in the bases of the complementary DNA strand. 3-TATAATTACGCTAGATCACCCACT5 2. Transcribe the mRNA sequence using the bottom (3 to 5) strand as the template. What is the name of the sequence upstream of the gene that the RNA polymerase binds to? 3. 4. What polypeptide sequence would...
Most questions answered within 3 hours.
-
A study by Consumer Reports showed that 70% of supermarket
shoppers believe supermarket brands to be...
asked 37 seconds ago -
What volume of a 0.227 M hydrobromic acid solution is required
to neutralize 27.8 mL of...
asked 1 minute ago -
Consider a 1.0-L solution that is 0.260 M C6H5COOH and 0.73 M
NaC6H5COO at 25 °C....
asked 14 minutes ago -
The controller of the Red Wing Corporation is in the process of
preparing the company’s 2018...
asked 16 minutes ago -
C and C++ Console Application for Student Data
1- Write a function named Average that
a....
asked 16 minutes ago -
The popularity of inhalants grew after newspapers reported on
glue sniffing. Should newspapers and other media...
asked 15 minutes ago -
For which of the following P-values will the null hypothesis be
rejected when performing a level...
asked 29 minutes ago -
An assembly is formed by fitting a shaft into a bearing. The
outside diameters of the...
asked 24 minutes ago -
Assume there are 100,000 unique web pages* and answer the
following:
5a) A Google search returns...
asked 27 minutes ago -
A sample of size 65 will be drawn from a population with mean 22
and standard...
asked 29 minutes ago -
QUESTION 1
Competition for food would probably be most severe between
two
A.
closely related species...
asked 30 minutes ago -
When it comes to state and local funding, which of the following
statements are true? Select...
asked 33 minutes ago