Which statements are true and which statements are false? |
|||||||||||
|
Electrophoresis works by running an electrical charge through the gel. ( True)
because the two electrode are attached at opposite poles in the gel for separation of DNA fragments.
---
DNA has a negative charge. ( True)
because of presence of phosphate group, the DNA has negative charge.
---
Because of its charge, DNA will move towards the negatively charged side of the gel. ( False) .
because of the negative charge on DNA, the DNA will move towards the positive charged side of the gel. Because opposite charges attract each other.
---.
All DNA will move through the gel at the exact same rate ( false).
Because the smaller fragments run faster in the gel as compared to the larger fragment of the DNA.
Please rate.
Which statements are true and which statements are false? Question Selected Match Electrophoresis works by running...
S Summeldild Du pole so that the DNA migrates to the center of the gel The size standard should be near the negative pole and the DNA wells near the positive pole so that the DNA migrates to the center of the gel None of the above are correct Question 4 1 pts You set up a gel with the correct DNA and size standards in the correct well. The wells are placed near the positive pole and you turn...
1a) A band on an electrophoresis gel corresponds to _____ Choices: - the size standard - millions of fragments of the same size - a DNA fragment of a particular size - the blue tracking dye b) What is the function of the size standard? Choices: - it allows the researcher to calculate the unknown sizes of the DNA fragments by comparing then to then known sizes. - it marks the location where the fragments should line up. c) Longer...
Biologists use gel electrophoresis to sort DNA segments by size. DNA segments are placed at one end of a gel. DNA is negatively charged (with a charge of two electrons per base pair). When you “run the gel” you are generating an electric field by connecting anodes and cathodes at the ends of the gel. This causes the negatively charged DNA segments to move towards the positive electrode. After running the gel, smaller DNA segments have moved farther from the...
Question 4-12 points Biologists use gel electrophoresis to sont DNA segments by size. DNA segments are placed at one end of a gel. DNA is negatively chargod (with a charge of two electrons per base pair). When you "run the gel" you are generating an electric field by connecting anodes and cathodes at the ends of the gel This causes the negatively charged DNA segments to move towards the positive electrode. After nunning the gel, smaller DNA segments have moved...
Write true or false ______ 1. The DNA sequence of one human being is on average 99.9% identical to another random human being. ______ 2. As of 2009, all living human beings have had their entire genome sequenced. ______ 3. The nucleotide bases present in a DNA sequence are A, U, G, C. ______ 4. Techniques that enabled scientists to clone genes were developed in the 1970s. ______ 5. A restriction enzyme is useful because it is a generic enzyme...
Read the following three statements carefully and determine which are true and which are false. Nucleic acids are synthesized in the 3' - 5' direction. The sugar-phosphate groups which form the "backbone" of the DNA double-helix are located on the outside of the helix because they are polar. DNA polymerase "reads" its template strand by running along it in a 5' - 3' direction. 18. Read the following three statements carefully and determine which are true and which are false....
One strand of a DNA sequences is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. CP22: vne strand of a DNA sequence is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Number of bases in each fragment: Now compare the same region of DNA from another individual. Where...
Which of the following statements is FALSE about Southern blotting? a) smaller nucleic acid fragments move faster than larger nucleic acid fragments in gels b) a hybridization probe for Southern blot can be single stranded DNA or RNA c) In most cases, DNA is cut with a restriction enzyme prior to gel electrophoresis d) smaller hybridization probes will always detect smaller DNA fragments than larger probes e) Southern blotting is used to analyze DNA
Which of the following statements are true? a) The potential energy of the charge carriers is increased when they move through the battery and decreased when they move through the load. b) In an electrical circuit, the energy from the power source is transferred to the load by net transport of charge carriers. c) In a single loop circuit, the energy of a charge carrier is decreased non-negligibly upon traversing the circuit once. d) The energy of the charge carriers...
Which of the following statements are true? a) The potential energy of the charge carriers is increased when they move through the battery and decreased when they move through the load. b) In an electrical circuit, the energy from the power source is transferred to the load by net transport of charge carriers. c) In a single loop circuit, the energy of a charge carrier is decreased non-negligibly upon traversing the circuit once. d) The energy of the charge carriers...