Why is alkaline SDS used for plasmid DNA isolation but not for genomic DNA isolation?
Why is alkaline SDS used for plasmid DNA isolation but not for genomic DNA isolation?
Homework Answers
Alkaline SDS is used for plasmid DNA isolation as it contains sodium hydroxide and SDS which can used for denaturation. Genomic DNA is longer than plasmid DNA. Once genomic DNA is denatured it becomes tangled and cannot re-anneal properly in potassium acetate solution. But as plasmid DMA is smaller it is capable of re-annealing.
Long genomic DNA is tangled in insoluble glob and become contaminated by tangling with RNA and proteins. So, alkaline SDS used for plasmid DNA isolation but not for genomic DNA isolation.
Add Answer to:
Why is alkaline SDS used for plasmid DNA isolation but not for
genomic DNA isolation?
How to interpret the gel results following plasmid isolation (i.e., differentiate between plasmids, genomic DNA, and...
How to interpret the gel results following plasmid isolation (i.e., differentiate between plasmids, genomic DNA, and RNA)? ** I have a lab exam on this subject, could someone give me an example?
Purification of Plasmid DNA
Isolation of genomic DNA follows the same principles as that of obtaining plasmid from E. coli. Which of the following is not included in it?a) Cell lysisb) Removal of proteinsc) Removal of chromosomal DNAd) Dissolving plasmid in water
1. What are some reasons for isolating plasmid DNA? 2. What are the functions of sodium...
1. What are some reasons for isolating plasmid DNA? 2. What are the functions of sodium hydroxide and SDS in the cell lysis solution? What is the function of the potassium acetate solution? 3. What structural property of plasmid DNA allows it to be separated from chromosomal DNA during alkaline cell lysis? Was more than one band observed in your plasmid sample after electrophoresis and staining?
Suppose that your bacterial cell contained a plasmid. When you isolated "genomic" DNA, would you expect...
Suppose that your bacterial cell contained a plasmid. When you isolated "genomic" DNA, would you expect to obtain the plasmid DNA along with the chromosomal DNA? Explain.
Why is an intermediate like mRNA needed to copy the information from the genomic DNA so...
Why is an intermediate like mRNA needed to copy the information from the genomic DNA so it can be translated into proteins? Use an example to explain why would you need to extract genomic DNA? What is a plasmid? Where are plasmids found? Explain HOW plasmids play a role in the development of multiple drug resistant strains of bacteria
in the plasmid isolation procedure, phenol is the main denaturant that removes proteins from the lysed...
in
the plasmid isolation procedure, phenol is the main denaturant that
removes proteins from the lysed cells. how does phenol denature
proteins? why doesn't it denature DNA?
clue in the picture .
08. DNA and phenol are acids. Proteins are folded with many hydrogen and ionic surface bonds that phenol can attack.
why are plasmids easier to study than genomic DNA?
why are plasmids easier to study than genomic DNA?
3. (2 pts.) You are sequencing the end of a genomic DNA fragment that was cut...
3. (2 pts.) You are sequencing the end of a genomic DNA fragment that was cut with the restriction enzyme BamH1 and ligated into a plasmid that was also cut with BamH1. You have denatured the DNA and annealed a labeled primer to plasmid sequences adjacent t<o the insertion site as shown below: 3' BamHi 5' GATCTAGCTAGCTAGCTAGCTAGCTAGCTAGCCATCGATGCTAGGAATCTTTGCTGATGCTAGTCGATGCCGTAGC ACTACGATCAGCTACGGC 3' 18 base primer 5' Next you add DNA polymerase, buffer, an excess of all four dNTPs, and a small amount of...
7. You have performed a cloning experiment in which you digested genomic DNA from starfish cells...
7. You have performed a cloning experiment in which you digested genomic DNA from starfish cells with an enzyme and ligated the fragments into plasmid vectors digested with the same enzyme. The plasmid you are using contains a gene for ampicillin resistance and an MCS located within the Lacz gene. For the ligation, you added three times as much of the digested plasmid as the insert. After introducing the ligated DNA into cells, you observe 200 blue colonies and 33...
Why is plasmid DNA preferred for genetic engineering studies?
Why is plasmid DNA preferred for genetic engineering studies?
1. What are some reasons for isolating plasmid DNA? 2. What are the functions of sodium hydroxide and SDS in the cell lysis solution? What is the function of the potassium acetate solution? 3. What structural property of plasmid DNA allows it to be separated from chromosomal DNA during alkaline cell lysis? Was more than one band observed in your plasmid sample after electrophoresis and staining?
Why is an intermediate like mRNA needed to copy the information from the genomic DNA so it can be translated into proteins? Use an example to explain why would you need to extract genomic DNA? What is a plasmid? Where are plasmids found? Explain HOW plasmids play a role in the development of multiple drug resistant strains of bacteria
in
the plasmid isolation procedure, phenol is the main denaturant that
removes proteins from the lysed cells. how does phenol denature
proteins? why doesn't it denature DNA?
clue in the picture .
08. DNA and phenol are acids. Proteins are folded with many hydrogen and ionic surface bonds that phenol can attack.
3. (2 pts.) You are sequencing the end of a genomic DNA fragment that was cut with the restriction enzyme BamH1 and ligated into a plasmid that was also cut with BamH1. You have denatured the DNA and annealed a labeled primer to plasmid sequences adjacent t<o the insertion site as shown below: 3' BamHi 5' GATCTAGCTAGCTAGCTAGCTAGCTAGCTAGCCATCGATGCTAGGAATCTTTGCTGATGCTAGTCGATGCCGTAGC ACTACGATCAGCTACGGC 3' 18 base primer 5' Next you add DNA polymerase, buffer, an excess of all four dNTPs, and a small amount of...
7. You have performed a cloning experiment in which you digested genomic DNA from starfish cells with an enzyme and ligated the fragments into plasmid vectors digested with the same enzyme. The plasmid you are using contains a gene for ampicillin resistance and an MCS located within the Lacz gene. For the ligation, you added three times as much of the digested plasmid as the insert. After introducing the ligated DNA into cells, you observe 200 blue colonies and 33...
Why is plasmid DNA preferred for genetic engineering studies?
Most questions answered within 3 hours.
-
At the beginning of the year, Palermo Brothers, Inc., purchased
a new plastic water bottle making...
asked 22 minutes ago -
Calculate the change in the Gibbs energy of the system for the
following processes: a) 6.0...
asked 12 minutes ago -
1.
A hemophiliac male mates with a healthy female. what are the
possible genotypes for the...
asked 8 minutes ago -
After reading the Primary Care scenario in the Allied Health
Community, what could have been implemented...
asked 17 minutes ago -
A solution is prepared by dissolving 11.60 g of a mixture of
sodium carbonate and sodium...
asked 21 minutes ago -
1. Mini Case Study: Suppose that, in the future, most jobs will
be bid upon by...
asked 24 minutes ago -
Plantinga argues for the view that there is no solution to the
problem of moral evil....
asked 19 minutes ago -
For this Discussion, you examine a case study of
hearing-impaired children who developed their own language...
asked 24 minutes ago -
You could argue that even though Rockefeller clearly had
enormous market power (90% of the market)...
asked 23 minutes ago -
The moment of inertia of a disk rotating about its axis of
symmetry is Icm=1/2MR^2
The...
asked 31 minutes ago -
When using a relational database what makes data
formatting so important and critical to the functions...
asked 42 minutes ago -
The following temperatures show the (fictional) daily low
measured at O'Hare airport every January 1st from...
asked 1 hour ago