Treatment with the chemical Bls18 causes a nucleotide to be changed from a C to a G within the translated region of the MseOS gene. You find that in your treated cells, the protein is the same size, but has a different conformation/shape? Briefly explain how you knew that.
Bls18 causes a nucleotide to be changed from a C to a G. It means that mutated amino acid has a different property from the normal amino acid. Mutation either created a hydrophilic amino in place of the hydrophobic amino acid or vice-versa and amino is crucial for its conformation This change in the property broke the interaction of the normal amino acid with its nearby amino acid, which leads to loss of its function.
We can run the normal protein and mutated protein in the SDS-page and probe it with the antibody against it. If both the protein are giving the band at the same position then there is no change in the size of the protein.
To check it confirmation we need to rum the mutated and the normal protein on the native gel. if there is a change in the conformation of the protein then the mutated protein will show different migration pattern on the gel.
Treatment with the chemical Bls18 causes a nucleotide to be changed from a C to a G within the tr...
Treatment with the chemical Bls18 causes a nucleotide to be changed from a C to a G within the translated region of the MseOS gene. You find that in your treated cells, the protein is the same size, but has a different conformation/shape? Briefly explain how you knew that. (2-3 sentences)
Background info: Leishmania is a parasite that causes a disfiguring infection that is treated by antimony. Antimony works because the parasites have a transporter protein that imports the chemical into parasite cells. Doctors found that many infections had become resistant to antimony, the standard treatment for this infection.When they sequenced the genomes of Leishmania from treatment-resistant Leishmania, scientists found that the gene encoding the protein transporter contained two inserted nucleotides. Question: How would you explain to non-scientist patients how the...
Shown below is the anti-sense DNA sequence from a region of a gene that produces a specific protein. Mutations in this region of the gene cause a disease CTT TTA TAG TAG ATA CCA CAA AGG a. What is the mRNA strand that is transcribed from the DNA shown above? b. What is the amino acid sequence that would be translated from the mRNA strand you determined in part 1? c. If an individual has a G at position 15...
Question 2: Transcription, RNA Processing and Translation A particular gene codes for a mature mRNA transcript containing 1200 bases, which is translated into a protein containing 300 amino acids. A. How long is the coding sequence in this mRNA and how many nucleotides are in the UTRs? For the purposes of this question we are ignoring the G’ cap and the polyA tail. B. A mutant form of the gene created by one nucleotide being changed to another nucleotide also...
molecular biology Section C (40 marks) Answer ALL questions from this Section 5. You have isolated total RNA from muscle cells and constructeda muscle cDNA library. You wish to study the regulatory region of a muscle-specific cDNA gene (gene M) that you have previously identified. 6 (a) For your study, you need to isolate a genomic clone of gene M. Why isa cDNA clone of gene M not appropriate for your study? (2 marks) (b) Outline the steps you would...
2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5') CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA (3') 3. DNA polymerase made a mistake and added a C on the DNA template strand. In...
Protein P is synthesized in relatively high amounts in the human pancreas. This protein has been isolated and purified, but its amino acid sequence has not been determined. We wish to clone the gene for protein P. (a) How can a probe be prepared to identify the gene for protein P? (b) If we have prepared a radioactive messenger RNA as our probe in part (a), how could we verify that it is the mRNA for protein P? (c) If...
1. (a) Microorganisms can be used to remove chemical pollutants from the environment. ine gene cluster xyl encodes several enzymes that are involved in degrading toluene, and transcription of these genes is activated when the xylS protein (expressed continuously under a constitutively active promoter p) binds to toluene. Only then can the resulting xyls/toluene complex bind to the pm promoter to activate transcription of the genes in the xyl cluster. By considering the cellular location of the enzymes that degrade...
24. Now consider that same sequence as above except that the base marked with an asterisk (") is changed from a G to an A (see below), How does that change alter the outcome -CAUCGCUCAUGAACGCAG UUAGUCAGUAGUCCUGGACC- 3 a) That change does not alter the translation product. That change alters the translation product. That is an example of a missense mutation b) The change alters one of the translation products, This is an example of a missense mutation d) c) That...
1) Suppose that gene A 3,000 bp. Suppose that g contained within intron 1 opposite directions for the two genes. covers 10,000 base pairs (bp) and has 2 exons; the intron in gene A is ene B covers 1,500 bp and has two exons. Gene B is completely of gene A. The direction of the transcriptional bubble moves in A. Draw the genomic organization (i.e., exons and introns) of gene A AND gene B. Label the polarity of the DNA...