Question
Please help with 4-10!
DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this
Activity 13: DNA, Genes, and Protein Synthesis 5. During the second stage of protein synthesis the ribosome reads (or decod
Activity 13: DNA, Genes and Protein Synthesis 7. Re-write the mRNA strand you synthesized on step 4(c). a. Identify the codon
Activity 13: DNA, Genes,and Protein Synthesis 10. Most of the amino acids (except for Trp and Met) have more than one codon.
DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of DNA Write the nucleotide sequence of the complementary strand of DNA AGCTGACCTAGCGGACAA 4. Protein synthesis is a multi-step process (see model 2) First the genetic information contained in the DNA sequence is used to synthesize a new molecule of mRNA. Based on the information in model 2 answer the following: a. The process of synthesizing a mRNA strand is called b. In mRNA the complementary base of Adenine (A) is c. Write the mRNA strand that would be synthesized by the following DNA sequence: AGCT GACCTAGCGGACAA 41
Activity 13: DNA, Genes, and Protein Synthesis 5. During the second stage of protein synthesis the ribosome 'reads' (or decodes) the mRNA sequence to produce a specific polypeptide chain. Based on the information in model 2 answer the following: a. How may nucleotides on the mRNA strand codes for a single amino acid? b. The mRNA code that instructs for the placement of a specific amino acid is called a c. According to model 2 the codon for the amino acid tryptophan (Trp) is d. According to model 2 the codon for the amino acid serine (Ser) is e. How may codons are there in the mRNA strand you synthesized in step 4(c)? 6. his eu The table above lists the genetic code (or codons) for each of the 20 amino acids. Based on the information given in this table answer the following a. The codon for the amino acid Methionine Met) is b. The codon for the amino acid Leucine (Leu) is c. The codon CCC codes for the amino acid d. How many codon code for the amino acid Valine (Val)? e. How are the codons that code for Valine (identified above) different from one or 42
Activity 13: DNA, Genes and Protein Synthesis 7. Re-write the mRNA strand you synthesized on step 4(c). a. Identify the codons in the mRNA strand by placing a box around each of the codons. b. Write the amino acid sequence that would be synthesized by the mRNA strand. 8. Imagine that a mutation produces an mRNA strand, shown below, in which the second codon is ACC (instead of ACU as in 4c). UCGACCGGAUCGCCUGUU a. What is the amino acid sequence produced by this mutation? b. Would this mutated protein have the same structure and function as the original protein identified in 7b? Briefly explain. 9. Imagine that a mutation produces an mRNA strand, shown below, in which the second codon is CCU (instead of ACU as in 4c). UCGCCUGGAUCGCCUGUU a. What is the amino acid sequence produced by this mutation? b. Would this mutated protein have the same structure and function as the original protein identified in 7b? Briefly explain. 43
Activity 13: DNA, Genes,and Protein Synthesis 10. Most of the amino acids (except for Trp and Met) have more than one codon. advantage (if any) is there to have more than one codon per amino acid? What
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Lem C mine C TD cupion

Hope this helps you

Add a comment
Know the answer?
Add Answer to:
Please help with 4-10! DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete th...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2...

    DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2 Gene 1 Gene 3 DNA strand3 TRANSLATION Protein Trp Gly Model 2 ACTIVITY and QUESTIONS 1. Based on the information you can gather from model 1 complete the following sentences: a. The nucleotide Adenine (A) always pairs with the nucleotide b. The nucleotide Guanine (G) always pairs with the...

  • 50 LAB 2 Genetics EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise...

    50 LAB 2 Genetics EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise and answer the questions that follow. You will use the DNA strand from Exercise to make the protein for which it codes STEP 1 Review the imaginary strand of DNA below. Note the complementary base pairs. AGCAATCCGTCTTGG TCGTTAGG CAGAACC STEP 2 Draw the DNA strand separating down the middle las in the beginning of DNA replication STEP 3 Draw the free-floating RNA bases linking...

  • EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise and answer the questions...

    EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise and answer the questions that follow. You will use the DNA strand from Exercise 8 to make the protein for which it codes. STEP 1 Review the imaginary strand of DNA below. Note the complementary base pairs. AGCAATCCGTCTTGG TCGTTAGGCAGAACC STEP 2 Draw the DNA strand separating down the middle (as in the beginning of DNA replication). STEP 3 Draw the free-floating RNA bases linking up with the top...

  • Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand...

    Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand mRNA Sequence (List codons) Amino Acids in the Protein **Use the Genetic Code Chart on page 217 to determine the amino acids that will be placed in the protein Questions: 19. The three letter "code words of DNA and RNA that specify amino acids are called: A. codons B. promoters C. Introns D. anticodons 20. Proteins are composed of building blocks called: A. fatty...

  • c) The steps or rungs of the DNA ladder are composed of phosphate group 4 Deoxyribose...

    c) The steps or rungs of the DNA ladder are composed of phosphate group 4 Deoxyribose 15. Use Figure 2 and 3 of the lab to compare the genome of a human with a mouse, fruit fly and yeast. paired in a specific way. d) Adenine in one DNA strand always pain with thymine ) Bases in opposite strands of a DNA molecule are linked together by hydrogen in the other strand and bonds. Yeast Human Mouse Fruit Fly Number...

  • O ACTIVITY 5.4.1 Synthesis of a Protein: A Simulation Activity In this activity, you will be...

    O ACTIVITY 5.4.1 Synthesis of a Protein: A Simulation Activity In this activity, you will be provided with the DNA nucleotide sequence that codes for a hypothetical protein. The code will be provided to you in three fragments. You will have to tran- scribe the code into mRNA, remove an intron segment, and translate the mRNA into the protein. In addition, you will have to identify the beginning fragment the middle fragment, and the end fragment. Sequence A TCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGC CGCCAGGGCCCCGCCCCTCAGAAGTTGGT...

  • Complete the following table and answer the next two questions (3.5 marts) 10 B I =...

    Complete the following table and answer the next two questions (3.5 marts) 10 B I = U Ꭶ X2 x E I 19 эс ✓ C Finis DNA strand G C А DNA strand TAC TAC mRNA codon AUG C G G tRNA anticodon G - Amino acid Tryptophan Stop mRNA and tRNA are involved in producing proteins from genes in the DNA. One codon consisting of 3 nucleotides corresponds to an amino acid in the protein that gets built...

  • DNA exercises Ex. 1 Use the genetic code chart (Fig. 10.8A or the one in your...

    DNA exercises Ex. 1 Use the genetic code chart (Fig. 10.8A or the one in your LN) to translate the following mRNA sequences into amino acid sequences and answer the questions. mRNA nucleotide sequence (mRNA1) AUGGCAGACAAUAUUAAGUGA 1. What is the amino acid sequence? Mutation in the mRNA nucleotide sequence (mRNA2) AUGGCAGACCAUAUUAAGUGA 2. What is the new amino acid sequence? 3. How many bases were changed in mRNA2 compared to mRNA1? 4. What type of mutation was this? 5. How many...

  • please help!! In-lab Activity on DNA, DNA Replication and Pro Directions: Complete the color key belowing...

    please help!! In-lab Activity on DNA, DNA Replication and Pro Directions: Complete the color key belowing the Key to colors Adenine - blue Replication and Protein Synthesis Name the DNA modelin class. then awer the questions about the mode ThymineONOMI Deoxyribose Oangcor Red 1. Using the nitrogen base letters to repre your color key and this sequence of colors for the sen blue-blue-orange-yellow-orange-yello Cytosine yellow Guanine - Green COLOR CHOICES Yellow Purple Red Green Orange u to represent nucleotides, wide...

  • DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in...

    DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in process called DNA curs in the nucleus of s acest FS Parent strand Parent strand Newly replicated DNA Newly replicated DNA- SA0 Daughter DNA molecule Daughter DNA molecule Figure 8.2: Overview of DNA replication and illustration of complementary base pairing. DNA must replicate before cell division so that each new daughter cell receives an exact copy of the parent DNA. 1. Replication begins when...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
Active Questions
ADVERTISEMENT