Homework Answers
Add Answer to:
please help
2. (a) Draw a dideoxyribonucleotide terminator (ddNTP). Label carbons with 1" through 5'. Draw...
based on the given graph how would these be answered? sa sequence from a sheep PCR...
based on the given graph how would these be answered?
sa sequence from a sheep PCR product. The template used was genomic DNA and the forward and se primers were designed to amplify partofthe priongene, which encodes the causative agentot scrapie. is black;Cisblue; Ais green: Tisred. The forward primerwasusedasasequencing primer. TheNattheten ow means that the computer can't decide which nucleotide is at that position in the sequence because there are two peaks (red=T and blue-C) that are the same height....
i need help on the whole page! 24. What is the chemical group responsible for making...
i
need help on the whole page!
24. What is the chemical group responsible for making these amino acids acidic? 25. List the 3 amino acids that can be phosphorylated using single letter names 20. If you want to mutate Tyrosine (Y) to keep it from being negatively charged, but keep it as close keep it as close in shape as possible to tyrosine, which amino acid would you change it to Use the single letter name. being negatively charged...
Please help with all questions. I provided all the information that I have. The sequence below...
Please help with all questions. I provided all the information that I have. The sequence below represents the genomic DNA sequence of the first 440 bp of your gene of interest (exon 1 in blue). You want to amplify this full 440 bp region by PCR, for cloning into a plasmid vector. tgaagtccaactcctaagccagtgccagaagagccaaggacaggtacggctgtcatcacttagacctcaccctgtggagccacaccctagggttggccaatctactcccaggagcagggagggcaggagccagggctgggcataaaagtcagggcagagccatctattgcttacatttgcttctgacacaactgtgttcactagcaacctcaaacagacaccatggtgcatctgactcctgaggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggttgctatcaaggttacaagacaggtttaaggagaccaatagaaactgggcatgtggagacagagaagactcttgggtttctgataggcactgactctctctgcctattggtctattttcccaccc 1.1 Design a 20 nucleotide forward & reverse primer set that will allow you to amplify the sequence above. (note - primers should be at the beginning...
Please help with 4-10! DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete th...
Please help with 4-10!
DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...
please help me with both of these questions!!!! 3:33 PM Wed Mar 18 Enter answer... 5:06...
please help me with both of these questions!!!!
3:33 PM Wed Mar 18 Enter answer... 5:06 Exit You are trying to amplify an eye color gene in Drosophila. Based on the DNA sequence for the gene, you design the following primers: Forward Primer: 5' GCATGCTGAG CCTAGTAACT 3 Reverse Primer: 5' CTTAAAGCTT ACTGGTCAAC 3' True or false? These are good primers to use in PCR. Hint: use the formula: Tm (in C) = 4(G+C) + 2(A + T) True False ormula:...
NEED HELP WITH THESE QUESTIONS. PLEASE ANSWER ALL AND EXPLAIN AS WELL. THANKSSSSSSS 1. You want...
NEED HELP WITH THESE QUESTIONS. PLEASE ANSWER ALL AND EXPLAIN AS
WELL. THANKSSSSSSS
1. You want to clone a gene from a donor vector to a host vector. List the correct order of events in the process of cloning a. Perform ligation reaction of cloned gene and host vector. b. Perform double digestion of both donor and host vectors with the 2 restriction enzymes c. Examine donor and host vectors for restriction sites d. Purify cloned gene from donor vector...
Overview The purpose of this activity is to help the students to understand how replication, tran...
TranslationOverview:The purpose of this activity is to help the students to understand how replication, transcription, and translation are connected. Students will use a sequence from a bacterial gene that confers resistance to antibiotics (carbapenems). They will be asked to apply the knowledge obtained in the class lecture to (1) find the promoter in the sequence, (2) determine the amino acid sequence of a fragment of the polypeptide, (3) "reverse translate" a fragment of the polypeptide, and (4) identify mutations in...
a) Please draw the nucleotide sequence AC, from DNA; start at 5' and draw the backbone...
a) Please draw the nucleotide sequence AC, from DNA; start at 5' and draw the backbone vertically down the page. Please draw a 5' phosphate and 3' hydroxyl. b) Please draw just the bases of the complementary strand, including a "squggle bond" to indicate the attachment to the ribose; mark hydrogen bonds with the standard dashed lines. c) Please label the bases of both strands with their names. d) Please explain why you would lose points in part c if...
please explain answer to number 4 and 5 NATIONAL CENTER FOR CASE STUDY TEACHING IN SCIENCE...
please explain answer to number 4 and 5
NATIONAL CENTER FOR CASE STUDY TEACHING IN SCIENCE Part II - Song Titles Let's continue with our music analogy by reading a short gene, turning it into mRNA sequence (transcription), and then tuming the mRNA sequence into a protein (translation), which will give us a song title. This will be a small protein, which is often referred to as a "peptide." There are many peptides that are important in biological systems. Some...
Use the lab manual to answer the following questions in COMPLETE SENTENCES. 1.Read through the introduction....
Use
the lab manual to answer the following questions in COMPLETE
SENTENCES.
1.Read through the introduction. Answer the questions in
between each historical section.
2. Describe tge activity that you ate doung for investygation
3. What does lysis and protease mean?
3. Which disease is describe in investigation 4?
what mutation?
PRE-LAB: LAB EXERCISE 7 Directions: Use the lab manual to answer the following questions in COMPLETE SENTENCES AND IN YOUR OWN WORDS. Use your own handwriting, do NOT type!...
based on the given graph how would these be answered?
sa sequence from a sheep PCR product. The template used was genomic DNA and the forward and se primers were designed to amplify partofthe priongene, which encodes the causative agentot scrapie. is black;Cisblue; Ais green: Tisred. The forward primerwasusedasasequencing primer. TheNattheten ow means that the computer can't decide which nucleotide is at that position in the sequence because there are two peaks (red=T and blue-C) that are the same height....
i
need help on the whole page!
24. What is the chemical group responsible for making these amino acids acidic? 25. List the 3 amino acids that can be phosphorylated using single letter names 20. If you want to mutate Tyrosine (Y) to keep it from being negatively charged, but keep it as close keep it as close in shape as possible to tyrosine, which amino acid would you change it to Use the single letter name. being negatively charged...
Please help with 4-10!
DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...
please help me with both of these questions!!!!
3:33 PM Wed Mar 18 Enter answer... 5:06 Exit You are trying to amplify an eye color gene in Drosophila. Based on the DNA sequence for the gene, you design the following primers: Forward Primer: 5' GCATGCTGAG CCTAGTAACT 3 Reverse Primer: 5' CTTAAAGCTT ACTGGTCAAC 3' True or false? These are good primers to use in PCR. Hint: use the formula: Tm (in C) = 4(G+C) + 2(A + T) True False ormula:...
NEED HELP WITH THESE QUESTIONS. PLEASE ANSWER ALL AND EXPLAIN AS
WELL. THANKSSSSSSS
1. You want to clone a gene from a donor vector to a host vector. List the correct order of events in the process of cloning a. Perform ligation reaction of cloned gene and host vector. b. Perform double digestion of both donor and host vectors with the 2 restriction enzymes c. Examine donor and host vectors for restriction sites d. Purify cloned gene from donor vector...
TranslationOverview:The purpose of this activity is to help the students to understand how replication, transcription, and translation are connected. Students will use a sequence from a bacterial gene that confers resistance to antibiotics (carbapenems). They will be asked to apply the knowledge obtained in the class lecture to (1) find the promoter in the sequence, (2) determine the amino acid sequence of a fragment of the polypeptide, (3) "reverse translate" a fragment of the polypeptide, and (4) identify mutations in...
a) Please draw the nucleotide sequence AC, from DNA; start at 5' and draw the backbone vertically down the page. Please draw a 5' phosphate and 3' hydroxyl. b) Please draw just the bases of the complementary strand, including a "squggle bond" to indicate the attachment to the ribose; mark hydrogen bonds with the standard dashed lines. c) Please label the bases of both strands with their names. d) Please explain why you would lose points in part c if...
please explain answer to number 4 and 5
NATIONAL CENTER FOR CASE STUDY TEACHING IN SCIENCE Part II - Song Titles Let's continue with our music analogy by reading a short gene, turning it into mRNA sequence (transcription), and then tuming the mRNA sequence into a protein (translation), which will give us a song title. This will be a small protein, which is often referred to as a "peptide." There are many peptides that are important in biological systems. Some...
Use
the lab manual to answer the following questions in COMPLETE
SENTENCES.
1.Read through the introduction. Answer the questions in
between each historical section.
2. Describe tge activity that you ate doung for investygation
3. What does lysis and protease mean?
3. Which disease is describe in investigation 4?
what mutation?
PRE-LAB: LAB EXERCISE 7 Directions: Use the lab manual to answer the following questions in COMPLETE SENTENCES AND IN YOUR OWN WORDS. Use your own handwriting, do NOT type!...
Most questions answered within 3 hours.
-
convert grams into vloume with the density of water being at
.997514 g/cm^3 at 23.1 Celsuis...
asked 57 minutes ago -
Foreman company obtained a $20,000, 6% loan on May 1, 2018.
Principal and interest will be...
asked 1 hour ago -
5. Problem 11.05 (Discounted Payback)
eBook
Project L costs $60,000, its expected cash inflows are $14,000
per...
asked 1 hour ago -
1. Which of the following is true about politics and health
organizations?
A. Health organizations are...
asked 1 hour ago -
A space vehicle is coasting at a constant velocity of 18.1 m/s
in the +y direction...
asked 2 hours ago -
5) Use the following balanced equation to answer questions
(a)-(i).
3 Cu(s) + 8 HNO3(aq) →...
asked 2 hours ago -
A three-year maturity bond with a 12% annual coupon rate is
currently traded at par $1000...
asked 2 hours ago -
1.
What is the minimum volume to use in the Spec 20 cuvette in order
to...
asked 3 hours ago -
A builder wants to install wall-to-wall carpeting in a living
room of length 8.87 m and...
asked 3 hours ago -
Organizational change can produce anxiety in those affected by
the change. In what ways can change...
asked 3 hours ago -
Ozone in the atmosphere may react with nitric oxide.
From the following data, calculate the DG...
asked 3 hours ago -
Steven Long, a bond analyst, is analyzing a convertible bond.
The characteristics of the bond are...
asked 3 hours ago